Application of human TRIP13 gene and related medicine thereof

A gene and drug technology, applied in the use of human TRIP13 gene and related drug fields, can solve the problem of less TRIP13 gene and other problems

Pending Publication Date: 2018-03-09
SHANGHAI GENECHEM
View PDF3 Cites 2 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0004] At present, there are few reports on the TRIP13 gene in tumor-related fields

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Application of human TRIP13 gene and related medicine thereof
  • Application of human TRIP13 gene and related medicine thereof
  • Application of human TRIP13 gene and related medicine thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0068] Example 1 Preparation of RNAi lentivirus against human TRIP13 gene

[0069] 1. Screening for effective siRNA targets against the human TRIP13 gene

[0070] Retrieve TRIP13 (NM_004237) gene information from Genbank; design effective siRNA targets for TRIP13 gene. Table 1 lists the effective siRNA target sequences for the TRIP13 gene.

[0071] Table 1 is targeted at the siRNA target sequence of human TRIP13 gene

[0072] SEQ ID NO

Target Seq

1

gctactcaacagacatatat

[0073] 2. Preparation of lentiviral vector

[0074] Aim at the siRNA target (taking SEQ ID NO: 1 as an example) to synthesize a double-stranded DNA Oligo sequence (Table 2) with Age I and EcoR I restriction endonucleases at both ends; use Age I and EcoR I restriction enzyme Act on the pGCSIL-GFP carrier (provided by Shanghai Jikai Gene Chemical Technology Co., Ltd., figure 1 ), to linearize it, and identify the digested fragments by agarose gel electrophoresis.

[0075] Table ...

Embodiment 2

[0096] Example 2 Real-time fluorescent quantitative RT-PCR method to detect the silencing efficiency of TRIP13 gene

[0097] Human breast cancer MCF-7 cells in the logarithmic growth phase were digested with trypsin to make a cell suspension (the number of cells was about 5×10 4 / ml) were inoculated in a 6-well plate and cultured until the cell confluency reached about 30%. According to the multiplicity of infection (MOI, MCF-7:20) value, an appropriate amount of the virus prepared in Example 1 was added, the culture medium was replaced after 24 hours of cultivation, and the cells were collected after the infection time reached 5 days. Total RNA was extracted according to the instruction manual of Trizol from Invitrogen. According to the M-MLV instruction manual of Promega Company, RNA was reverse-transcribed to obtain cDNA (see Table 7 for the reverse transcription reaction system, react at 42° C. for 1 h, and then bathe in a water bath at 70° C. for 10 min to inactivate rev...

Embodiment 3

[0105] Example 3 Detection of proliferation ability of tumor cells infected with TRIP13-siRNA lentivirus

[0106] Human breast cancer MCF-7 cells in the logarithmic growth phase were digested with trypsin to make a cell suspension (the number of cells was about 5×10 4 / ml) were inoculated in a 6-well plate and cultured until the cell confluency reached about 30%. According to the multiplicity of infection (MOI, MCF-7:20), an appropriate amount of virus was added, and the culture medium was replaced after 24 hours of culture. After the infection time reached 5 days, the cells in each experimental group in the logarithmic growth phase were collected. The complete medium was resuspended into a cell suspension (2×10 4 / ml), inoculate a 96-well plate at a cell density of about 2000 / well. 5 replicate wells in each group, 100 μl per well. After laying the board, place at 37°C, 5% CO 2 Incubator cultivation. From the second day after plating, the plate was detected and read once ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses application of a human TRIP13 gene and a related medicine thereof, discloses application of the human TRIP13 gene in preparation of tumor treatment medicines, further establishes small interfering RNA (ribonucleic acid) of the human TRIP13 gene, an interfering RNA builder of the human TRIP13 gene and an interfering chronic virus of the human TRIP13 gene, and discloses application thereof. The siRNA or the RNA builder and chronic virus containing the siRNA sequence can be used for specifically inhibiting the expression of the human TRIP13 gene; especially, the chronic virus can efficiently infect the target cell, the expression of the TRIP13 gene in the target cell can be inhibited at high efficiency, the growth of the tumor cell is further inhibited, the withering of the tumor cell is promoted, and the important significance is realized in tumor treatment.

Description

technical field [0001] The present invention relates to the field of biotechnology, and more specifically relates to the use of human TRIP13 gene and related medicines. Background technique [0002] RNA interference (RNA interference, RNAi) is the use of short double-stranded RNA (dsRNA) composed of nucleotides for post-transcriptional gene silencing. It can efficiently and specifically block the expression of a specific gene in the body, leading to its degradation, thereby causing the silencing of a specific gene in the organism, and causing the cells to show the absence of a certain gene phenotype. It is a commonly used research gene emerging in recent years. Functional, laboratory techniques for finding cures for disease. Studies have shown that double-stranded RNA with a length of 21-23nt can specifically cause RNAi at the transcriptional and post-transcriptional levels (Tuschl T, Zamore PD, Sharp PA, Bartel DP.RNAi: double-stranded RNA directs the ATP-dependent cleavag...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): C12N15/113C12N15/867C12N7/01A61K48/00A61K31/713A61P35/00
CPCC12N7/00C12N15/113C12N15/86C12N2310/14C12N2740/15043C12N2740/15021C12N2310/531
Inventor朱向莹陈琳沈克吴涛金杨晟曹跃琼
OwnerSHANGHAI GENECHEM