A kind of SGRNA and the chronic virus carrier and application they built

A lentiviral vector, recombinant lentivirus technology, applied in lentiviral vector, clinical treatment application of human liver tumor patients, and liver arterial embolization field, can solve problems such as obvious treatment defects, and achieve great potential for clinical use, obvious effect, To achieve effective treatment and life extension effect

Active Publication Date: 2019-11-26
SHENZHEN PEOPLES HOSPITAL
View PDF2 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

For this reason, TAE / TACE surgery for HCC patients has obvious treatment defects, and the long-term adverse consequences after surgery need to be paid attention to and resolved

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • A kind of SGRNA and the chronic virus carrier and application they built
  • A kind of SGRNA and the chronic virus carrier and application they built
  • A kind of SGRNA and the chronic virus carrier and application they built

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0044] Example 1: Detection of the expression of HIF1-α in HCC tumor tissue

[0045] The method for detecting the expression of HIF1-α in HCC tumor tissue comprises the steps of:

[0046] 1. Western blot detection of HIF1-α expression in HCC tumor tissue

[0047] (1) Sample preparation: 1) Hepatobiliary and pancreatic surgery in Shenzhen People's Hospital took tumors and paracancerous tissues from patients with HCC liver cancer, and stored them in liquid nitrogen; 2) Added liquid nitrogen and grinded quickly to obtain tumor and normal tissue powder, RIPA lysate Lyse the sample; 3) Centrifuge at 12000g / min at 4°C for 20 minutes; 4) Transfer the supernatant to a new tube, measure the protein concentration with a protein quantification kit, and record it, add 1 / 5 volume of 5× The loading buffer was mixed with a gun and boiled in a boiling water bath for 5 minutes; 5) Centrifuged at the maximum speed of 4°C for 10 minutes; 6) The supernatant was transferred to a new tube and ali...

Embodiment 2

[0074] Example 2: Construction of CRISPR / Cas9 lentivirus targeting HIF1-α gene knockout

[0075] The method for constructing the CRISPR / Cas9 lentivirus comprises the steps:

[0076] 1. Construction of pLenti-CAS-sg719 / sg720 / sg721-egfp plasmid

[0077] The target sgRNAs (including sgRNA719, sgRNA720 and sgRNA721) targeting the first exon sequence of HIF-1α were designed by online software (www.crispr.mit.edu). The nucleotide sequences of the three sgRNAs designed are as follows:

[0078] sgRNA719 (SEQ ID NO.1): CCTCACACGCAAATAGCTGA;

[0079] sgRNA720 (SEQ ID NO.2): TACTCATCCATGTGACCATG;

[0080] sgRNA721 (SEQ ID NO.3): GTTATGGTTCTCACAGATGA;

[0081] The target sgRNAs were inserted into the plasmid pLenti-CAS-sgRNA-egfp (GeneChem, Shanghai) and identified by sequencing, and pLenti-CAS-sg719 / sg720 / sg721-egfp was successfully constructed, as shown in Figure 2(A);

[0082] As shown in Figure 2(A), we designed three different sgRNAs targeting the first exon sequence of HIF-1α,...

Embodiment 3

[0098] Example 3: Knockout of SMMC-7721 cells and HCC tumor HIF1-α gene by lentivirus expressing CRISPR / Cas9

[0099] 1. Infection of SMMC-7721 cells with lentivirus expressing CRISPR / Cas9

[0100] (1) will 3×10 5 A SMMC-7721 cell (ATCC, USA) was plated in a 6-well plate, and two cell plates were plated in total. The cells were cultured in DMEM (GIBCO) with complete medium, including 10% FBS (GIBCO);

[0101] (2) After culturing for 8 hours, add LV-Ctrl, LV-H719, LV-H720 and LV-H721 to the supernatant culture solution, add Polybrene (Sigma), and repeat 3 times for each sample;

[0102] (3) After 6-8 hours, remove the supernatant medium and add fresh medium; in the hypoxia experiment, 150 μM CoCl should be added to the medium 2 (Sigma) as a hypoxia inducer;

[0103] (4) After 48 hours, collect the cells and take a part of the flow cytometry (C6, BD Biosciences) to detect the expression rate of GFP positive cells;

[0104] (5) Use the QIAamp DNA blood kit (QIAGEN) to extra...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

PropertyMeasurementUnit
melting pointaaaaaaaaaa
melting pointaaaaaaaaaa
Login to view more

Abstract

Provided are an sgRNA, a lentivirus vector constructed therefrom, and an application thereof. The nucleotide sequence of the sgRNA is as shown in SEQ ID NOs. 1-3. The present invention uses the currently most efficient gene-editing tool, CRISPR / Cas9, and the designed HIF-1α gene sgRNA locus has better gene knockout activity than other loci reported in previous studies. By combining with TAE / TACE surgery for the first time, the present invention can be used in HCC tumor treatment.

Description

technical field [0001] The present invention relates to the field of biological gene therapy, in particular to a sgRNA and its constructed lentiviral vector and its application, in particular to the construction of a lentivirus expressing CRISPR / Cas9 and targeted knockout of the HIF-1α gene and its combination with the hepatic artery Embolization for clinical application in patients with human liver tumors. Background technique [0002] As the fifth most malignant tumor in the world, the lethality rate of hepatocellular carcinoma (HCC) ranks among the top three among all tumors. The treatment situation of HCC is not optimistic in recent decades. HCC accounts for about 85% to 90% of primary liver cancer. Data show that in 2012, there were 782,500 new cases of liver cancer worldwide, and 745,500 patients died of liver cancer. At present, the clinical techniques used in the treatment of liver cancer include surgical resection and orthotopic liver transplantation. Studies have...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
Patent Type & Authority Patents(China)
IPC IPC(8): C12N15/113C12N15/867C12N7/01A61K48/00A61P35/00C12R1/93
CPCA61K48/0008A61K48/0058A61P35/00C07K14/70567C12N7/00C12N15/113C12N15/86C12N2310/10C12N2740/15021C12N2740/15043C12N2800/107
Inventor 刘利平鲍世韵刘权
Owner SHENZHEN PEOPLES HOSPITAL
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap