A plant Medicago truncatula flower organ stigma exposure gene and its encoded protein and application

A technology with exposed stigma and gene encoding, applied in the field of genetic engineering, can solve the problems of increasing the difficulty and cost of crop hybrid breeding, low outcrossing rate of sterile lines, and high cost

Active Publication Date: 2022-02-08
THE INST OF BIOTECHNOLOGY OF THE CHINESE ACAD OF AGRI SCI
View PDF4 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

For alfalfa and soybean crops with small flower type and complex structure, artificial detassellization and hybridization are time-consuming, labor-intensive and labor-intensive, which increases the difficulty and cost of crop hybrid breeding
At the same time, due to the low outcrossing rate of their sterile lines, the yield of hybrid seed production is low and the cost is high, which restricts the industrialization process of alfalfa and soybean hybrids

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • A plant Medicago truncatula flower organ stigma exposure gene and its encoded protein and application
  • A plant Medicago truncatula flower organ stigma exposure gene and its encoded protein and application
  • A plant Medicago truncatula flower organ stigma exposure gene and its encoded protein and application

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0029] 1. Obtaining and phenotypic analysis of cabl2 mutants

[0030] By screening the Tnt1 insertion mutant library of Medicago truncatula, a mutant NF19675 with exposed stigma, folded and fused petals, and stamens wrapped inside the petals was obtained, named cabl2( cab bag- l ike).

[0031] The flower phenotype observation results of cabl2 mutant and Medicago truncatula R108 (wild type) are shown in figure 1 . figure 1 Among them, A-D are the phenotype diagrams of wild-type flowers at different stages of flower development; F-H are flower phenotype diagrams of cabl2 mutants at different stages of flower development; D-E wild-type flowers form normal fruit pods after pollination; I-J cabl2 mutants, due to petal fusion, As a result, the stamens are wrapped, and normal pollination cannot be completed, and finally normal fruit pods cannot be formed.

[0032] Second, mutation analysis

[0033] Because the mutant stigma is exposed, in order to study the fertility of the mut...

Embodiment 2

[0034] Cloning of embodiment 2CABL2 gene

[0035] According to the flanking sequence of NF19675 published on the Tnt1 website (https: / / medicago-mutant.noble.org / mutant / ), corresponding primers were designed to detect the linkage between the mutant and the gene. Finally, a gene CABL2 linked to the mutant was found;

[0036] NF19675-F TCATGGACGTTAGTTGGAAA;

[0037] NF19675-R AAGCACATTACCAGACATGA;

[0038] In the NF19675 mutant, Tnt1 was inserted in the second exon of the gene. In order to prove that the CABL2 gene is the control gene of the mutant, we ordered another mutant of this gene: NF14424, inserted in the third exon. And named the previous NF19675 as cabl2-1 (see figure 2 A). Observing the phenotype of the homozygous mutant of cabl2-2, it was found that the phenotype of cabl2-1 was exactly the same. In cabl2-1, cabl2-2 homozygous mutant species, the full-length expression of CABL2 gene was completely lost ( figure 2 B). It proved that the CABL2 gene is the contr...

Embodiment 3

[0039] Example 3 The acquisition of CABL2 gene and its encoded protein CABL2

[0040] 1. Extract the RNA of the blooming flower of Medicago truncatula R108 (wild type), and reverse transcribe it into cDNA.

[0041] 2. Using the cDNA obtained in step 1 as a template, amplify using a primer pair composed of primer CABL2-F and primer CABL2-R to obtain a PCR amplification product.

[0042] CABL2-F: 5'-caccATGGAGATAGAGCAAGACAATGCC-3';

[0043] CABL2-R: 5'-ATGAAATGGAGAGTTGAGACCCTCC-3'.

[0044] 3. Sequence the PCR amplification product obtained in step 2 to obtain the coding region sequence of the target gene, as shown in SEQ ID NO: 1 in the sequence listing, and encode the protein shown in SEQ ID NO: 2 in the sequence listing. It consists of 689 amino acid residues. The CDS of the gene was compared on the Medicago truncatula website (http: / / blast.jcvi.org / Medicago-Blast / ), and the genome sequence of the CABL2 gene was obtained, as shown in SEQ ID NO:3. The protein shown in SEQ ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a stigma exposed gene of the flower organ of the plant Medicago truncatula and its coded protein and application. The gene is a DNA molecule as described in any of (a1)-(a4): (a1) the DNA molecule whose coding region is shown in SEQ ID NO.1; (a2) the DNA molecule shown in SEQ ID NO.3; (a3) a DNA molecule that hybridizes to the DNA sequence defined by (a1) or (a2) and encodes the protein of claim 1 under stringent conditions; (a4) is derived from Medicago truncatula and is combined with (a1) or (a2) or ( a3) A DNA molecule with more than 90% homology to the defined DNA sequence. The gene of the invention can control the exposure of plant stigma and the fusion of petals; it lays a theoretical basis for the study of CABL2 gene regulating the exposure of stigma in plants.

Description

technical field [0001] The invention belongs to the technical field of genetic engineering, and in particular relates to a stigma-exposed gene of the flower organ of the plant Medicago truncatula and its coded protein and application. Background technique [0002] Flowers are the unique reproductive organs of angiosperms. The normal development of flower organs is directly related to the reproduction of species. Legumes are typical Papilionaceae plants, which are different from radially symmetrical flowers such as Arabidopsis. The flower organs of Papilionaceae plants are mostly bilaterally symmetrical, and the corolla is butterfly-shaped. It consists of 5 petals of different sizes and shapes, among which the larger and unpaired petal is the flag petal; there is a wing-shaped petal on both sides of the flag petal, called the wing petal; there is another pair of petals on the inner side of the wing petal, which are fused into a Scaphoid, wrapped outside the pistil and stamen...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityPatents(China)
IPC IPC(8): C12N15/29C07K14/415
CPCC07K14/415
Inventor林浩祝步拓李辉牛丽芳
OwnerTHE INST OF BIOTECHNOLOGY OF THE CHINESE ACAD OF AGRI SCI