A carrier for improving plant disease resistance and its application

A disease resistance and plant technology, applied in the direction of application, plant peptides, plant products, etc., to achieve the effects of improving disease resistance, reducing adaptation costs, and improving disease resistance

Active Publication Date: 2021-01-12
ZHEJIANG UNIV
View PDF1 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

At present, there have been many reports on the use of various regulatory elements to regulate the expression of the NPR1 gene in Arabidopsis to provide plant resistance in plants, but the use of specific expression regulatory elements to mediate the expression of the NPR1 gene in monocotyledonous plants, thereby improving Plant disease resistance, research to reduce the cost of its application is still rare

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • A carrier for improving plant disease resistance and its application
  • A carrier for improving plant disease resistance and its application
  • A carrier for improving plant disease resistance and its application

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0032] Embodiment 1 vector construction

[0033] 1. Obtain expression control regions AtTBF1-D and OsTBF1-D (structure such as figure 1 shown).

[0034] PCR primers AtTBF1-D-F (5'CAAGCTTCGACGACTAGTTTACAGAGAATTT) and AtTBF1-D-R (5'GGATCCCTTTTTTTTATTTTACCACAGAAAAAT) were designed, and AtTBF1-D was amplified by PCR using Arabidopsis genomic DNA as a template. The PCR reaction conditions were: 95°C for 3 minutes; 95°C for 15 seconds, 68°C for 15 seconds, 72°C for 4 minutes, repeating 32 cycles; and then 72°C for 10 minutes. The obtained PCR product of approximately 3.6 Kb was cloned into the pCambia1300 vector. Then, AtTBF1-D was obtained by double digestion with HindIII and BamHI, and DNA sequence determination showed that the nucleotide sequence was correct (SEQ ID NO: 1).

[0035] PCR primers OsTBF1-D-F (5'GGTACCGATTTATAAATGCTGCTTTCACTGC) and OsTBF1-D-R (5'ATGGATCCCCTAACGCTATGATCTCTTTCTC) were designed to obtain pUBI by PCR amplification using the genomic DNA of commercial m...

Embodiment 2

[0059] Embodiment 2 corn transformation

[0060] Maize transformation technology is relatively mature. References such as: Vladimir Sidorov & David Duncan (in M. Paul Scott (ed.), Methods in Molecular Biology: Transgenic Maize, vol: 526; Yuji Ishida, Yukoh Hiei & Toshihiko Komari (2007) Agrobacterium-mediated transformation of maize. Nature Protocols 2: 1614-1622 The basic method is as follows: get the Hi-II corn ear of 8-10 days after pollination, collect all immature embryos (size is 1.0-1.5mm).The T-DNA prepared in embodiment 1 is carried pCambia1300-AtTBF1- D-ZmNPR1–p35S-G10, pCambia1300-OsTBF1-D-OsNPR1–p35S-G10 and pCambia1300-AtTBF1-D-AtNPR1–p35S-G10 Agrobacterium and immature embryos were co-cultured on the medium (MS+2mg / L 2,4-D+30g / L sucrose+3g / L agar (sigma 7921)+40mg / L acetosyringone) for 2-3 days (22°C). Transfer immature embryos to callus induction medium ( MS+2mg / L 2,4-D+30g / L sucrose+2.5g / L gelrite+5mg / L AgNO 3 +200mg / L acetosyringone), cultured in the dark a...

Embodiment 3

[0061] Embodiment 3, transformation of rice

[0062] The method of obtaining transgenic rice is to adopt the existing technology (Lu Xiongbin, Gong Zuxun (1998) Life Science 10: 125-131; Liu Fan et al. (2003) Molecular Plant Breeding 1: 108-115). The mature and plump seeds of "Xiushui-134" were dehulled, and callus was induced as transformation materials. Take the vectors pCambia1300-AtTBF1-D-ZmNPR1-p35S-G10, pCambia1300-OsTBF1-D-OsNPR1-

[0063] Agrobacterium plating of p35S-G10 and pCambia1300-AtTBF1-D-AtNPR1–p35S-G10. Pick a single colony to inoculate and prepare Agrobacterium for transformation. The callus to be transformed is put into the Agrobacterium bacterium liquid that OD is about 0.6 (preparation of Agrobacterium bacterium liquid: Agrobacterium is inoculated to culture medium, cultivated to OD is about 0.6; Medium composition: 3g / L K 2 HPO 4 , 1g / LNaH 2 PO 4 , 1g / LNH 4 Cl, 0.3g / L MgSO 4 ·7H 2 O, 0.15g / L KCl, 0.01g / L CaCl 2 , 0.0025g / LFeSO 4 ·7H 20, 5g / L ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

No PUM Login to view more

Abstract

The invention discloses a vector for improving disease resistance of plants and an application of the vector. The vector consists of an expression control zone and a plant NPR1 gene through operable connection, wherein the expression control zone comprises an immune inducible promoter and a pathogen-related upstream open reading frame. Compared with non-GMO, the plant disease resistance obtained through the vector is improved by 50% or above; compared with constitutive promoters such as corn ubiquitin promoter pUBI, the expression of the NPR1 gene is mediated by the expression control zone, and the adaptability cost is reduced by 80% or above. Meanwhile, the NPR1 gene expression, medicated by the expression control zone, of monocotyledons is more beneficial to improvement of the disease resistance of monocotyledons corn and rice than expression of the NPR1 gene of medicated dicotyledons, and the disease resistance is improved by 5% or above.

Description

[0001] (1) Technical field [0002] The present invention relates to an expression control region composed of an immune-inducible promoter and an upstream open reading frame (uORF) associated with a pathogen, and a vector constructed by operably connecting the NPR1 gene of a monocotyledonous plant. Method for transgenic plants with increased disease resistance. [0003] (2) Background technology [0004] Plants are constantly attacked by various disease-causing organisms including viruses, bacteria, fungi and nematodes. However, most plants have innate mechanisms to resist disease-causing organisms. Natural variations that confer resistance to plant pathogens have been identified and bred into many crop plants by plant breeders and pathologists. These natural disease resistance genes generally provide a high level of resistance or immunity against pathogens. [0005] When plants are invaded by diseases and insect pests, the injured part will immediately initiate programmed c...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
Patent Type & Authority Patents(China)
IPC IPC(8): C12N15/82C12N15/29A01H5/00A01H6/46
CPCC07K14/415C12N15/8279
Inventor 张先文王东芳沈志成
Owner ZHEJIANG UNIV
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap