Duplex-specific chimeric antigen receptor molecule and application thereof to tumor therapy
A chimeric antigen receptor and specific technology, used in anti-tumor drugs, cancer antigen components, antibody medical components, etc., to enhance targeting, strong specificity, and prevent recurrence.
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0059] Embodiment 1. Construction of human BCMA stable expression cell line
[0060] 1.1 Construction of plasmid vector
[0061] The vector system used in this example belongs to the third-generation self-inactivating lentiviral vector system. There are three plasmids in this system, namely the packaging plasmid psPAX2 encoding the protein Gag / Pol and the Rev protein; and the envelope plasmid pMD2 encoding the VSV-G protein. .G and the recombinant plasmid pCDH-CMV-huCD19-EF1-GFP-T2A encoding human BCMA extracellular region and transmembrane region based on the empty vector pCDH-CMV-MCS-EF1-GFP-T2A-Puro (purchased from Addgene) - Puro.
[0062] According to the human BCMA sequence provided by Genbank accession number NM_001192.2, using the gene synthesis method based on PCR bridging, synthesize the signal peptide, human BCMA extracellular region, transmembrane region, and intracellular region, through the primer pair
[0063] SEQ ID NO:187(huBCMA-F):5>ATGTTGCAGATGGCTGGGCAG<...
Embodiment 2
[0076] Example 2 Screening and verification of specific single-chain antibody (scFv) in conjunction with human BCMA
[0077] 2.1 Screening of anti-human BCMA-specific single chain antibody based on phage display
[0078] Using the single-chain antibody phage display technology, the single-chain antibody sequence that specifically binds to human BCMA was screened from the directional engineered human single-chain antibody phage library.
[0079] To achieve this purpose, inoculate 400ml of 2×YT / ampicillin culture medium with glycerol bacteria (self-built library) displaying the natural library of fully human single-chain antibody on phage, so that the cell density reaches OD600=0.1, at 37°C and 200rpm Culture with shaking until the cell density reaches OD600=0.5. use 10 12 Pfu's M13KO7 helper phage (purchased from ThermoFisher) was infected, and incubated at 30° C. and 50 rpm for 30 minutes. After adding 50mg / L kanamycin, shake and culture at 37°C and 200rpm for 30 minutes,...
Embodiment 3
[0096] Embodiment 3, preparation and activity analysis of the antibody of anti-BCMA
[0097] 3.1 Construct light chain and heavy chain eukaryotic expression vectors for the selected single-chain antibody, transfect HEK293F to induce recombinant expression and purify. The light chain and heavy chain in the single-chain antibody sequence obtained in Example 1 were respectively constructed into the monoclonal antibody expression plasmid pCMV-V5-Fc, and the plasmid was prepared in large quantities after the sequence was confirmed to be correct. The expression plasmids of the above light chain and heavy chain were mixed in an appropriate ratio and then transfected into well-growing HEK-293F cells at 37°C, 5% CO 2 , 125rpm shaker continuously cultivated for 7 days, centrifuged at 4000rpm for 10min, removed the precipitate, collected the supernatant, and filtered it with a 0.45 μm filter membrane, and carried out affinity purification of the processed sample with a Protein A (purch...
PUM

Abstract
Description
Claims
Application Information

- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com