Supercharge Your Innovation With Domain-Expert AI Agents!

Duplex-specific chimeric antigen receptor molecule and application thereof to tumor therapy

A chimeric antigen receptor and specific technology, used in anti-tumor drugs, cancer antigen components, antibody medical components, etc., to enhance targeting, strong specificity, and prevent recurrence.

Active Publication Date: 2019-03-22
CELLYAN THERAPEUTICS WUHAN CO LTD
View PDF8 Cites 12 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Since the patient received autologous hematopoietic stem cell transplantation, the effect of CAR-T cell therapy does not exclude the role of ASCT

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Duplex-specific chimeric antigen receptor molecule and application thereof to tumor therapy
  • Duplex-specific chimeric antigen receptor molecule and application thereof to tumor therapy
  • Duplex-specific chimeric antigen receptor molecule and application thereof to tumor therapy

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0059] Embodiment 1. Construction of human BCMA stable expression cell line

[0060] 1.1 Construction of plasmid vector

[0061] The vector system used in this example belongs to the third-generation self-inactivating lentiviral vector system. There are three plasmids in this system, namely the packaging plasmid psPAX2 encoding the protein Gag / Pol and the Rev protein; and the envelope plasmid pMD2 encoding the VSV-G protein. .G and the recombinant plasmid pCDH-CMV-huCD19-EF1-GFP-T2A encoding human BCMA extracellular region and transmembrane region based on the empty vector pCDH-CMV-MCS-EF1-GFP-T2A-Puro (purchased from Addgene) - Puro.

[0062] According to the human BCMA sequence provided by Genbank accession number NM_001192.2, using the gene synthesis method based on PCR bridging, synthesize the signal peptide, human BCMA extracellular region, transmembrane region, and intracellular region, through the primer pair

[0063] SEQ ID NO:187(huBCMA-F):5>ATGTTGCAGATGGCTGGGCAG<...

Embodiment 2

[0076] Example 2 Screening and verification of specific single-chain antibody (scFv) in conjunction with human BCMA

[0077] 2.1 Screening of anti-human BCMA-specific single chain antibody based on phage display

[0078] Using the single-chain antibody phage display technology, the single-chain antibody sequence that specifically binds to human BCMA was screened from the directional engineered human single-chain antibody phage library.

[0079] To achieve this purpose, inoculate 400ml of 2×YT / ampicillin culture medium with glycerol bacteria (self-built library) displaying the natural library of fully human single-chain antibody on phage, so that the cell density reaches OD600=0.1, at 37°C and 200rpm Culture with shaking until the cell density reaches OD600=0.5. use 10 12 Pfu's M13KO7 helper phage (purchased from ThermoFisher) was infected, and incubated at 30° C. and 50 rpm for 30 minutes. After adding 50mg / L kanamycin, shake and culture at 37°C and 200rpm for 30 minutes,...

Embodiment 3

[0096] Embodiment 3, preparation and activity analysis of the antibody of anti-BCMA

[0097] 3.1 Construct light chain and heavy chain eukaryotic expression vectors for the selected single-chain antibody, transfect HEK293F to induce recombinant expression and purify. The light chain and heavy chain in the single-chain antibody sequence obtained in Example 1 were respectively constructed into the monoclonal antibody expression plasmid pCMV-V5-Fc, and the plasmid was prepared in large quantities after the sequence was confirmed to be correct. The expression plasmids of the above light chain and heavy chain were mixed in an appropriate ratio and then transfected into well-growing HEK-293F cells at 37°C, 5% CO 2 , 125rpm shaker continuously cultivated for 7 days, centrifuged at 4000rpm for 10min, removed the precipitate, collected the supernatant, and filtered it with a 0.45 μm filter membrane, and carried out affinity purification of the processed sample with a Protein A (purch...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides a duplex-specific chimeric antigen receptor. The duplex-specific chimeric antigen receptor is composed of a signal peptide, two specific antigen binding fragments, an extra-membrane spacer region, a transmembrane region and an intracellular costimulatory signal region, wherein a first antigen which is recognized and bound by the specific antigen binding fragments is one of CD19, CD20, CD22, CD33, CD269, CD138, CD79a, CD79b, CD23, ROR1, CD30, a B cell surface antibody light chain, CD44, CD123, LewisY, CD7 or CD46; a second antigen which is recognized and bound by the specific antigen binding fragments is CD38; the two specific antigen binding fragments are connected through one connection peptide; the duplex-specific chimeric antigen receptor can be used for respectively recognizing two tumor-related antigens through constructing a low-affinity chimeric antigen receptor and a high-affinity chimeric antigen receptor and has very strong specificity. Furthermore, theinvention further provides application of the duplex-specific chimeric antigen receptor to tumor therapy.

Description

technical field [0001] The invention relates to the field of cell immunotherapy, in particular to a bispecific chimeric antigen receptor molecule and its application in tumor treatment. Background technique [0002] With the development of tumor immunology theory and clinical technology, chimeric antigen receptor T-cell immunotherapy (CAR-T) has become one of the most promising tumor immunotherapy. Chimeric antigen receptor CAR consists of a tumor-associated antigen-binding region, an extracellular hinge region, a transmembrane region, and an intracellular signal transduction region. CAR-T cell therapy uses exogenous gene transfection technology to express fusion proteins of single-chain fragment variable (scFv) that recognizes tumor-associated antigens and T cell activation sequences on the surface of T cells, enabling specific recognition of tumor-associated antigens. The scFv of the antigen is coupled to the activation and proliferation signal domain in T cells through t...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C07K19/00C12N15/62C12N5/10C12N7/01A61K35/17A61P35/00A61P37/02A61P31/12
CPCA61P31/12A61P35/00A61P37/02A61K35/17C12N7/00C07K14/7051C07K16/2878C07K16/2896C07K2317/92C07K2317/622C07K2319/33C07K2319/02C12N2740/15021C12N2510/00C07K2317/31C07K2317/21A61K39/0011A61K2039/5156C07K2319/03C07K2317/73A61K2039/505A61K38/00C07K16/2815A61K39/001126A61K39/001117A61K35/545A61K47/65A61K45/06C07K14/70514C07K14/70578A61K38/177C07K19/00A61K38/1774
Inventor 金丹李璐李国龙华权高
Owner CELLYAN THERAPEUTICS WUHAN CO LTD
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More