Unlock instant, AI-driven research and patent intelligence for your innovation.

Application of integrin β4 in preparation of reagent or medicine for distinguishing colon cancer and rectal cancer

An integrin, colon cancer technology, applied in biochemical equipment and methods, microbial determination/inspection, etc., can solve problems such as distinguishing tumor sources

Active Publication Date: 2022-04-29
THE FIRST HOSPITAL OF HEBEI MEDICAL UNIV
View PDF1 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

For tumors arising at the junction of the rectum and the sigmoid colon, there is no effective way to clearly distinguish the tumor source

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Application of integrin β4 in preparation of reagent or medicine for distinguishing colon cancer and rectal cancer
  • Application of integrin β4 in preparation of reagent or medicine for distinguishing colon cancer and rectal cancer

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0028] Example 1 Protein Screening

[0029] Use Human Genecards (http: / / www.genecards.org / ) and Compartments database (https: / / compartments.jensenlab.org / Downloads) to analyze the distribution of human proteins or polypeptides, and obtain 4433 secreted proteins; through BioGPS GeneAtlas U133A (http: / / biogps.org / dataset / GSE1133 / geneatlas-u133a-gcrma / ) database and NC160on U133A (http: / / biogps.org / dataset / BDS_00011 / nci60-on-u133a-gcrma / ) database analysis , found that 23 secreted proteins, including integrin β4 (ITGB4, namely CD104), were expressed in colorectal cancer tissues (compared with normal colon tissues) and colorectal cancer cell lines (compared with other tissue-derived cells) obvious change.

Embodiment 2

[0030] Example 2 Determination of the Threshold Range of Integrin β4 Expression

[0031] The expression of ITGB4mRNA was analyzed on the colon cancer, rectal cancer and their corresponding paracancerous tissues collected from the First Hospital of Hebei Medical University, using the real-time quantitative PCR method (ABI7500 model), PCR conditions: 95°C for 10 seconds, 60°C 30 seconds, 72°C for 30 seconds, 42 cycles; primer F: TCTCTCAGAGTGAGCTGGCAG, R: TTCAGCAGCTGGTACTCCAC; internal reference is GAPDH, and the relative expression calculation method is It was found that the difference between normal tissue and cancer tissue was not significant. In further analysis, it was accidentally found that there was a significant difference in expression between colon cancer and rectal cancer, p<0.05.

[0032] After verification of 16 cases of rectal cancer tissues and 29 cases of colon cancer tissues, when the threshold value was determined to be 0.01fold, the ROC curve was drawn by SPS...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The present invention disclosed the application of integrated β4 in distinguishing between colon and rectal cancer, including the following steps: 1) Filtering the protein that changes the patient's colorectal cancer compared with normal tissue; 2) Step 1) Screening out of the screeIntegen β4; 3) Compare the integrated β4 expression in the colon cancer tissue with the expression volume of integrated component β4 in the rectal cancer tissue; and 4) determine the threshold of the integrated β4 expression that distinguish between rectal and colon cancer β4Scope; thereby filling the gaps in the field of colon cancer and rectal cancer through molecular biology detection methods, thereby better distinguish between knots and rectal cancer tumors.

Description

technical field [0001] The invention relates to the field of biotechnology, in particular to the application of integrin β4 in distinguishing colon cancer and rectal cancer. Background technique [0002] Colorectal cancer is one of the common malignant tumors of the digestive system, including colon cancer and rectal cancer. It ranks third in the incidence of male malignant tumors and second in the incidence of female malignant tumors in the world. In recent years, affected by dietary structure and lifestyle, the incidence of colorectal cancer has risen significantly in my country, especially in big cities, and has leapt to the second place in the incidence of malignant tumors, and the prevention and treatment work is severe. Colorectal cancer often has no obvious symptoms in the early stage, which is often ignored and delays the timing of early diagnosis and treatment. According to the World Health Organization, cancer screening and early diagnosis and treatment are the m...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C12Q1/6886
Inventor 赵增仁姜霞王桂琦田延锋张磊翟从劼于卫芳
Owner THE FIRST HOSPITAL OF HEBEI MEDICAL UNIV