Application of integrin β4 in preparation of reagent or medicine for distinguishing colon cancer and rectal cancer
An integrin, colon cancer technology, applied in biochemical equipment and methods, microbial determination/inspection, etc., can solve problems such as distinguishing tumor sources
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0028] Example 1 Protein Screening
[0029] Use Human Genecards (http: / / www.genecards.org / ) and Compartments database (https: / / compartments.jensenlab.org / Downloads) to analyze the distribution of human proteins or polypeptides, and obtain 4433 secreted proteins; through BioGPS GeneAtlas U133A (http: / / biogps.org / dataset / GSE1133 / geneatlas-u133a-gcrma / ) database and NC160on U133A (http: / / biogps.org / dataset / BDS_00011 / nci60-on-u133a-gcrma / ) database analysis , found that 23 secreted proteins, including integrin β4 (ITGB4, namely CD104), were expressed in colorectal cancer tissues (compared with normal colon tissues) and colorectal cancer cell lines (compared with other tissue-derived cells) obvious change.
Embodiment 2
[0030] Example 2 Determination of the Threshold Range of Integrin β4 Expression
[0031] The expression of ITGB4mRNA was analyzed on the colon cancer, rectal cancer and their corresponding paracancerous tissues collected from the First Hospital of Hebei Medical University, using the real-time quantitative PCR method (ABI7500 model), PCR conditions: 95°C for 10 seconds, 60°C 30 seconds, 72°C for 30 seconds, 42 cycles; primer F: TCTCTCAGAGTGAGCTGGCAG, R: TTCAGCAGCTGGTACTCCAC; internal reference is GAPDH, and the relative expression calculation method is It was found that the difference between normal tissue and cancer tissue was not significant. In further analysis, it was accidentally found that there was a significant difference in expression between colon cancer and rectal cancer, p<0.05.
[0032] After verification of 16 cases of rectal cancer tissues and 29 cases of colon cancer tissues, when the threshold value was determined to be 0.01fold, the ROC curve was drawn by SPS...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 

