Check patentability & draft patents in minutes with Patsnap Eureka AI!

PCR primers, PCR methods and kits for detecting Staphylococcus cocci

The technology of a staphylococcus and a kit is applied in the field of detection of pathogenic microorganisms, and can solve the problems of unfavorable early identification, rapid detection or control of the infection of the bacteria, no specific PCR method for Staphylococcus korea, and difficulty in distinguishing bacteria, etc. Achieve the effect of simple and easy operation of result analysis, shortening detection time, and not easy to misjudgment

Active Publication Date: 2022-08-09
SUZHOU XISHAN BIOLOGICAL TECH
View PDF0 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0004] In the prior art, most of the identification methods of the bacteria are biochemical identification by isolation and culture of the bacteria, and at the same time, they are determined according to the morphological characteristics and biochemical characteristics of the bacteria. However, the method of first culturing and then identification takes a long period, usually at least 4-4 years. 7 working days; the operation requirements for the experimenter are high, and the experimenter needs to judge and identify the size, shape, color, shape, etc. of the colony; moreover, the morphological characteristics of the bacteria in the Staphylococcus genus are similar and difficult to distinguish, so the traditional detection method It is not conducive to early identification, rapid detection or control of the infection of this bacteria
Moreover, the sensitivity of this method is low, and there may be missed detection; it needs to be combined with the results of biochemical identification to determine whether there is a strain
[0005] With the development of biotechnology, molecular biology techniques are more and more applied to the detection of pathogenic microorganisms. The existing methods also include the PCR method, which is based on the amplification of the bacterial 16s rDNA gene and combined with sequencing. However, There is no specific PCR method for Staphylococcus kosheri

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • PCR primers, PCR methods and kits for detecting Staphylococcus cocci
  • PCR primers, PCR methods and kits for detecting Staphylococcus cocci
  • PCR primers, PCR methods and kits for detecting Staphylococcus cocci

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0064] Example 1 Common bacterial standard strains and DNA samples

[0065] Standard strains: 1 strain of Staphylococcus korekii subsp. urealyticum (ATCC 49330), 14 strains of Staphylococcus koreai isolates, 3 strains of Staphylococcus xylose, 3 strains each of Staphylococcus epidermidis and Staphylococcus squirrels, 2 strains of Staphylococcus lentus, 2 strains of Staphylococcus equisetum, 1 strain of Staphylococcus wornerii, 1 strain of Staphylococcus capitis, 1 strain of Staphylococcus hemolyticus, 1 strain of Staphylococcus cruzi, a total of 32 strains, and 7 other strains such as: Vitis aureus Coccus, Pseudomonas aeruginosa, Klebsiella pneumoniae, Escherichia coli, Clostridium sporogenes, Bacillus cereus, Corynebacterium murine, etc. All strains are stored at -70 ℃ in our laboratory.

[0066] Bacterial genomic DNA extraction kit (Tiangen Biochemical Technology Co., Ltd., DP302) was used to extract bacterial genome nucleic acid for specific experiments of PCR method.

Embodiment 2

[0067] Example 2 DNA extraction from clinical samples

[0068] 20 mouse fecal samples (about 50 mg each) were collected in a sterile environment, and nucleic acid was extracted with a bacterial genomic DNA extraction kit (Tiangen Biochemical Technology Co., Ltd., DP302). The operation was carried out in strict accordance with the kit instructions, and the DNA was washed with 60 μL After taking off, store at -20°C until use.

Embodiment 3

[0069] Example 3 Primer Design and Synthesis

[0070] Primers were designed using Primer Premier 5 primer design software according to the HSP60 gene sequence of S.

[0071] Upstream primer SEQ ID NO.1:

[0072] 5’-GTAGAAGGTATGCAATTCGAC-3’

[0073] Downstream primer SEQ ID NO.2:

[0074] 5’-GGATATGGTCTTTCTAACTCT-3’

[0075] The size of the amplified fragment was 92 bp. All primers were synthesized by Suzhou Jinweizhi Biotechnology Co., Ltd., as shown in SEQ ID NO.3.

[0076] SEQ ID NO. 3:

[0077] GTAGAAGGTATGCAATTCGACAGAGGTTATCAATCTCCATATATGGTCACAGATTCAGATAAAATGGTTGCAGAGTTAGAAAGACCATATCC

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
melting pointaaaaaaaaaa
Login to View More

Abstract

The present application belongs to the field of detection of pathogenic microorganisms, and relates to PCR primers, detection methods, and applications of the detection methods for the detection of Staphylococcus korea. High detection primers, fluorescent quantitative PCR methods and detection kits. The primers include an upstream primer and a downstream primer, the nucleotide sequence of the upstream primer is the sequence shown in SEQ ID NO.1, the nucleotide sequence of the downstream primer is the sequence shown in SEQ ID NO.2, and the The PCR method includes at least obtaining the upstream primer and the downstream primer by Primer Premier 5 design according to the Staphylococcus korekii heat shock protein HSP60 gene, and the kit provides at least the upstream primer and the downstream primer, or using the PCR method.

Description

technical field [0001] The present application belongs to the field of detection of pathogenic microorganisms, and relates to the detection of Staphylococcus korekis, in particular to PCR primers for detecting Staphylococcus korekis, a detection method and the application of the detection method. Specifically, the present application provides a pair of detection primers, a fluorescent quantitative PCR method and a detection kit with good specificity and high sensitivity for Staphylococcus korsi. Background technique [0002] Staphylococcal infections are zoonotic infectious diseases caused by pathogenic bacteria within the genus Staphylococcus. Bacteria of this genus are widely present in the skin and mucous membranes of the respiratory tract, upper gastrointestinal tract, and urogenital tract of mammals. They generally invade the body through wounds, and most of them will cause purulent diseases and systemic sepsis in different parts of the body; in addition, staphylococcal...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C12Q1/689C12Q1/6851C12Q1/14C12R1/44
CPCC12Q1/689C12Q1/6851C12Q2563/107C12Q2531/113Y02A50/30
Inventor 王立鹏朱明星时长军
Owner SUZHOU XISHAN BIOLOGICAL TECH
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More