A kind of group b meningococcus fhbp-v3 recombinant protein and its preparation method, vaccine composition, use
A vaccine composition, fhbp-v3 technology, applied in botany equipment and methods, biochemical equipment and methods, chemical instruments and methods, etc., can solve the problem of low immunogenicity and can not be used for research on group B meningococcal vaccines, etc. question
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0035] The construction of embodiment 1.fHbp-V3 prokaryotic expression plasmid
[0036] 1.1. Obtain gene sequence
[0037] The nucleotide sequence of the fHbp-V3 gene as shown in seq ID NO.2 was obtained from the subvariant V3.94 strain of the fHbp gene of group B meningococcal meningitis preserved by the China Center for Disease Control and Prevention through conventional PCR gene amplification, The PCR primers used for amplification were: upstream primer: TGACCTGCCTCATTGATGC, downstream primer: GCCGTCCGAACACGATAATTTACCG, PCR conditions were pre-denaturation at 95°C for 5 minutes; denaturation at 95°C for 30s; annealing at 60°C for 30s; extension at 72°C for 60s; 30 cycles; 72°C After extension for 5min;
[0038] 1.2 Codon optimization:
[0039] In order to better express the target protein, remove the signal peptide nucleotide sequence of the fHbp gene shown in seq ID.NO.2 and use lasergene software to optimize the codon preference synthesis of E. coli to obtain the nucleo...
Embodiment 2
[0053] The establishment of embodiment 2.fHbp-V3 prokaryotic expression strain
[0054] The correctly sequenced fHbp-V3 prokaryotic expression plasmid was transformed into BL21 (DE3) competent cells, spread on LB solid medium containing kanamycin resistance, and picked colonies into test tubes containing 5ml liquid LB medium, 37 Cultivate on a shaker with a rotation speed of 180 rpm until the OD value of the bacterial solution reaches 0.2-0.4, add 5 μL of IPTG (isopropyl-β-D-thiogalactoside) to induce expression, and collect the bacterial cells at 12000 rpm after 3 hours of induction , resuspended with PBS solution and run SDS-PAGE protein electrophoresis to identify the expression of bacterial protein. image 3 Shown is the expression of fHbp-V3 prokaryotic expression protein strain.
Embodiment 3
[0055] Expression and purification of embodiment 3.fHbp-V3 recombinant protein
[0056] 3.1. Expression of fHbp-V3 recombinant protein
[0057] 1) Inoculate 50 μL of fHbp-V3 prokaryotic expression bacterial solution with high expression level into a test tube containing 10 mL of liquid LB medium, culture on a shaker at 37°C with a rotation speed of 180 rpm overnight, and inoculate into 2 L of liquid LB culture medium the next morning cultured in cultured flasks.
[0058] 2) Cultivate until the OD value of the bacterial solution reaches 0.2-0.4, add 2mL of IPTG to induce expression, and express for 20h at 16°C on a shaker with a rotation speed of 180rpm.
[0059] 3) The bacterial solution was centrifuged at 8000rpm for 30min, the bacterial cells were collected, and the bacterial cells were resuspended with 200mL of Tris solution with a pH of 7.5 and 30mM / L to form a bacterial cell suspension.
[0060] 4) Use a high-pressure homogenizer to crush the bacteria, the crushing cond...
PUM
| Property | Measurement | Unit |
|---|---|---|
| absorbance | aaaaa | aaaaa |
Abstract
Description
Claims
Application Information
Login to View More