Check patentability & draft patents in minutes with Patsnap Eureka AI!

Vector and its construction and application based on the crispr/cas9 SunTag system for inhibiting geminivirus infection

A gemini virus and vector technology, applied in the field of genetic engineering, can solve problems such as uncertainty, changes in plant agronomic traits, escape editing, etc., to achieve a wide range of applications and reduce the possible effect of off-target

Active Publication Date: 2022-01-18
INST OF PLANT PROTECTION CHINESE ACAD OF AGRI SCI
View PDF5 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0006] (3) The breeding of geminivirus-resistant crop varieties is slow, and the field effect is not ideal
Overexpression of host endogenous genes and mutant materials may cause changes in the agronomic traits of plants, and there are potentially large uncertainties;
[0007] (4) The antiviral effect of the currently widely used CRISPR / Cas9 system is mainly to cut the target virus, and there is a risk of virus evolution and escape editing. If virus mutants are formed, it will pose a greater security threat to agricultural production

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Vector and its construction and application based on the crispr/cas9 SunTag system for inhibiting geminivirus infection
  • Vector and its construction and application based on the crispr/cas9 SunTag system for inhibiting geminivirus infection
  • Vector and its construction and application based on the crispr/cas9 SunTag system for inhibiting geminivirus infection

Examples

Experimental program
Comparison scheme
Effect test

Embodiment Construction

[0182] like Figure 1-3 As shown, a method for constructing pEG302-A and pEG302-β based on the CRISPR / Cas9 Sun Tag system to express the DRM2 gene target Chinese tomato yellow leaf curl virus to inhibit virus infection, specifically includes the following steps:

[0183] (1) Select the PAM site in the TYLCCNV sequence and design the gRNA; including the six gRNA chains required for the three targets required by the pEG302-A vector: g16-A / B, g17-A / B, g9A-A / B; Its sequence is shown in SEQ ID: No.1-6;

[0184] g16-A:ATTGTCTGGTGACGCGGACAGTGG

[0185] g16-B: AAAACCCACTGTCCGCGTCACCAGA

[0186] g17-A:ATTGGCACTTTAAAGAATTCATGG

[0187] g17-B: AAAACCCATGAATTCTTTAAAGTGC

[0188] g9A-A:ATTGGGCCATCCGTATAATATTAC

[0189] g9A-B:AAACGTAATATTATACGGATGGCC

[0190] (2) Synthesize the single-stranded gRNA described in (1) into a double strand, and the specific method is as follows:

[0191] ① Dilute the above single-stranded gRNA to 50uM / uL;

[0192] ②According to 5×Oligo Buffer: 4uL; sin...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a vector for inhibiting geminivirus infection based on the CRISPR / Cas9 SunTag system and its construction and application. The method utilizes the CRISPR / dCas9 Sun Tag system carrying the methyltransferase DRM2 to construct a vector targeting specific regions of TYLCCNV and TYLCCNB. sgRNA, so that the specific regions of TYLCCNV and TYLCCNB are recognized and methylated by DRM2. In order to enhance the effects of recognition and methylation, three sgRNAs (g16 / g17 / g9A) targeting TYLCCNV and three sgRNAs (g1 / g14 / g9B) targeting the methylation-sensitive regions of TYLCCNB were designed respectively, and the three sgRNAs The pEG302 vector was inserted in order to obtain a vector for inhibiting geminivirus infection that can target and modify TYLCCNV pEG302-A and target and perform methylated TYLCCNB pEG302-β.

Description

technical field [0001] The invention relates to the field of genetic engineering, in particular to a vector based on CRISPR / Cas9 Sun Tag system to express DRM2 gene target TYLCCNV so as to inhibit gemini virus infection and a construction method and application thereof. Background technique [0002] Tomato yellow leaf curl China virus (TYLCCNV) is a widespread gemini virus in my country, and it is accompanied by satellite molecule Chinese tomato yellow leaf curl virus beta (TYLCCNB) in the field. Infect Solanaceae crops together. TYLCCNV / TYLCCNB is transmitted by Bemisia tabaci, the susceptible tomato plants are dwarfed, the growth is slow or stagnant, the top leaves are often slightly chlorotic, yellow, and smaller, the leaf margins are rolled up, the leaves are thickened, the leaf quality is hardened, and the veins on the back of the leaves are often Vivid purple. At present, the disease has broken out on a large scale in my country, causing serious damage to a variety of...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C12N15/82C12N15/66A01H5/00A01H6/82
CPCC12N15/8203C12N15/8213C12N15/66
Inventor 李方方李浩龚攀周雪平
Owner INST OF PLANT PROTECTION CHINESE ACAD OF AGRI SCI
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More