Check patentability & draft patents in minutes with Patsnap Eureka AI!

CRISPR/Cas9 SunTag system based vector for inhibiting geminivirus infection, and construction and applications thereof

A geminivirus and vector technology, applied in the field of genetic engineering, can solve problems such as slow breeding of geminivirus-resistant crop varieties, escape editing, and threats to agricultural production safety

Active Publication Date: 2020-05-01
INST OF PLANT PROTECTION CHINESE ACAD OF AGRI SCI
View PDF5 Cites 3 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0006] (3) The breeding of geminivirus-resistant crop varieties is slow, and the field effect is not ideal
Overexpression of host endogenous genes and mutant materials may cause changes in the agronomic traits of plants, and there are potentially large uncertainties;
[0007] (4) The antiviral effect of the currently widely used CRISPR / Cas9 system is mainly to cut the target virus, and there is a risk of virus evolution and escape editing. If virus mutants are formed, it will pose a greater security threat to agricultural production

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • CRISPR/Cas9 SunTag system based vector for inhibiting geminivirus infection, and construction and applications thereof
  • CRISPR/Cas9 SunTag system based vector for inhibiting geminivirus infection, and construction and applications thereof
  • CRISPR/Cas9 SunTag system based vector for inhibiting geminivirus infection, and construction and applications thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment Construction

[0182] Such as Figure 1-3 As shown, a method for constructing pEG302-A and pEG302-β based on CRISPR / Cas9 Sun Tag system expressing DRM2 gene target Chinese tomato yellow leaf curl virus to suppress virus infection vector, specifically includes the following steps:

[0183] (1) Select the PAM site in the TYLCCNV sequence and design gRNA; including six gRNA strands required for the three targets required by the pEG302-A vector: g16-A / B, g17-A / B, g9A-A / B; its sequence is shown in SEQ ID: No.1-6;

[0184] g16-A:ATTGTCTGGTGACGCGGACAGTGG

[0185] g16-B:AAACCCACTGTCCGCGTCACCAGA

[0186] g17-A:ATTGGCACTTTAAAAGAATTCATGG

[0187] g17-B:AAACCCATGAATTCTTTAAAGTGC

[0188] g9A-A:ATTGGGCCATCCGTATAATATTAC

[0189] g9A-B:AAACGTAATATTATACGGATGGCC

[0190] (2) Synthesize the single-stranded gRNA described in (1) into double-stranded, the specific method is as follows:

[0191] ① Dilute the above single-stranded gRNA to 50uM / uL;

[0192] ②According to 5×Oligo Buffer: 4uL; single strand ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a CRISPR / Cas9 SunTag system based vector for inhibiting geminivirus infection, and construction and applications thereof. A method is to utilize a CRISPR / dCas9 Sun Tag system carrying methyltransferase DRM2 to construct sgRNAs for TYLCCNV and TYLCCNB specific areas, so that the TYLCCNV and TYLCCNB specific areas can be identified and methylated by the DRM2. In order to enhance identification and methylation effects, the methylation sensitive areas of three sgRNAs (g16 / g17 / g9A) targeting TYLCCNV and three sgRNAs (g1 / g14 / g9B) targeting TYLCCNB are respectively designed, so that the vector pEG302-A capable of performing fixed targeting and methylation modification on the TYLCCNV and the vector pEG302-beta capable of performing fixed targeting and methylation modification on the TYLCCNB can be obtained to inhibit geminivirus infection.

Description

technical field [0001] The present invention relates to the field of genetic engineering, in particular to a CRISPR / Cas9 Sun Tag system-based expression of DRM2 gene target TYLCCNV to inhibit geminivirus infection vector and its construction method and application. Background technique [0002] Tomato yellow leaf curl China virus (Tomato yellow leaf curl China virus, TYLCCNV) is a kind of geminivirus widely existing in my country, accompanied by satellite molecule Tomato yellow leaf curl China betasatellite (TYLCCNB) in the field Together they infect Solanaceae crops. TYLCCNV / TYLCCNB is transmitted by Bemisia tabaci. The infected tomato plants are dwarfed, grow slowly or stagnate, the top leaves are often slightly chlorotic, yellowish and smaller, the edges of the leaves are rolled up, the leaves are thickened, the leaf quality becomes hard, and the veins on the back of the leaves are often Show purple. At present, the disease has broken out on a large scale in my country, ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12N15/82C12N15/66A01H5/00A01H6/82
CPCC12N15/8203C12N15/8213C12N15/66
Inventor 李方方李浩龚攀周雪平
Owner INST OF PLANT PROTECTION CHINESE ACAD OF AGRI SCI
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More