CRISPR/Cas9 SunTag system based vector for inhibiting geminivirus infection, and construction and applications thereof
A geminivirus and vector technology, applied in the field of genetic engineering, can solve problems such as slow breeding of geminivirus-resistant crop varieties, escape editing, and threats to agricultural production safety
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment Construction
[0182] Such as Figure 1-3 As shown, a method for constructing pEG302-A and pEG302-β based on CRISPR / Cas9 Sun Tag system expressing DRM2 gene target Chinese tomato yellow leaf curl virus to suppress virus infection vector, specifically includes the following steps:
[0183] (1) Select the PAM site in the TYLCCNV sequence and design gRNA; including six gRNA strands required for the three targets required by the pEG302-A vector: g16-A / B, g17-A / B, g9A-A / B; its sequence is shown in SEQ ID: No.1-6;
[0184] g16-A:ATTGTCTGGTGACGCGGACAGTGG
[0185] g16-B:AAACCCACTGTCCGCGTCACCAGA
[0186] g17-A:ATTGGCACTTTAAAAGAATTCATGG
[0187] g17-B:AAACCCATGAATTCTTTAAAGTGC
[0188] g9A-A:ATTGGGCCATCCGTATAATATTAC
[0189] g9A-B:AAACGTAATATTATACGGATGGCC
[0190] (2) Synthesize the single-stranded gRNA described in (1) into double-stranded, the specific method is as follows:
[0191] ① Dilute the above single-stranded gRNA to 50uM / uL;
[0192] ②According to 5×Oligo Buffer: 4uL; single strand ...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More - R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com



