Check patentability & draft patents in minutes with Patsnap Eureka AI!

Novel preparation for treating triple-negative breast cancer

A triple-negative breast cancer and preparation technology, applied in the direction of medical preparations containing active ingredients, organic active ingredients, drug combinations, etc., can solve the problems of lack of treatment options and insensitivity of triple-negative breast cancer, and achieve good clinical application prospects , Inhibition of cell proliferation, migration and invasion inhibition

Inactive Publication Date: 2020-06-02
WEST CHINA HOSPITAL SICHUAN UNIV
View PDF1 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

At present, there is no standard and effective treatment plan for triple-negative breast cancer. Because its ER, PR and HER2 are all negative, endocrine therapy represented by tamoxifen or HER2-targeted therapy represented by trastuzumab are of no use. Insensitive, the chemotherapy regimen containing paclitaxel, anthracycline or platinum is still the main clinically

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Novel preparation for treating triple-negative breast cancer
  • Novel preparation for treating triple-negative breast cancer
  • Novel preparation for treating triple-negative breast cancer

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0029] Example 1 Preparation method of miR-200c-3p agomir of the present invention

[0030] Synthesize double-stranded nucleic acid according to the sequence of miR-200c-3p, the 3' end base of the sense strand is modified with cholesterol, the 5' end is modified with two bases, and the 3' end is modified with 4 bases, antisense The entire base of the chain was methylated to obtain miR-200c-3pagomir.

[0031] Among them, the sequence of miR-200c-3p is:

[0032] UAAUACUGCCGGGUAAUGAUGGA (SEQ ID NO. 1).

[0033] The beneficial effect of the present invention will be further illustrated by means of experimental examples below. The materials involved in the experiment example are as follows:

[0034] 1 Cell lines and experimental mice

[0035] Experimental mice: 5-week-old non-obese diabetic / severe combined immune deficiency (NOD / SCID) female mice weighing 18 grams were purchased from Beijing Weitong Lihua Experimental Animal Technology Co., Ltd.

[0036] Cell line: triple-nega...

experiment example 1

[0050] Experimental Example 1 Cell Experiment

[0051] 1 miR-200c-3p agomir proliferation inhibition experiment

[0052] MB-231 cells were treated with miR-200c-3p agomir (100-300nM) and paclitaxel (20nM). After 48 hours of administration, the proliferation experiment of thiazolium blue (MTT) was performed to detect the light absorption value (OD value), OD value The lower the value, the more obvious the inhibition of cell proliferation.

[0053] Proliferation experiment steps are as follows:

[0054] 1) MB-231 cells in the logarithmic growth phase were digested with trypsin and then prepared into a single cell suspension with a culture medium containing 10% fetal bovine serum. The number of 5,000 cells per well was inoculated into 96-well culture plates, and 5 replicate wells were set up in each group.

[0055] 2) Place the 96-well culture plate at 37°C with 5% CO 2 Incubate for 24 hours in a cell culture incubator.

[0056] 3) The specific drug concentration given by ea...

experiment example 2

[0090] Experimental Example 2 Transplanted Tumor Inhibition Experiment

[0091] In order to further study the effect of miR-200c-3p on triple-negative breast cancer in vivo, the inventors established xenograft tumor models in non-obese diabetic / severe combined immunodeficiency (NOD / SCID) female mice, and injected miR-200c-3p related formulation to observe its effect on tumor growth. Among them, the inventors used two miR-200c-3p preparations, one is miR-200c-3p agomir, and the other is adeno-associated virus (adeno-associated virus2 / 9, AAV2 / 9) expressing miR-200c-3p. agomir is a microRNA that has been specially chemically modified (cholesterol modification at the 3' end, two thiol modifications at the 5' end, four thiol modifications at the 3' end, and full base methylation modification on the antisense strand), which can be directly used in Injected in animals to simulate endogenous mature microRNA; adeno-associated virus is an efficient delivery vehicle for gene therapy, wh...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides a novel preparation for treating triple-negative breast cancer, and belongs to the field of anti-tumor preparations. The preparation of the invention is prepared from an miR-200c-3p agonist as the active ingredient and a pharmaceutically acceptable carrier. The preparation provided by the invention has a very obvious inhibitory effect on the proliferation, migration and invasion of the triple-negative breast cancer, and significantly inhibits growth of transplanted tumors of the triple-negative breast cancer in mice in vivo, thereby filling the gap of a targeted preparation of the triple-negative breast cancer.

Description

technical field [0001] The invention belongs to the field of antitumor preparations. Background technique [0002] Breast cancer is a malignant tumor originating from the normal epithelium of the mammary gland. Globally, the incidence of breast cancer is increasing year by year. About 2.08 million women are newly diagnosed with breast cancer every year, and nearly 620,000 people die from the disease. one. The incidence of breast cancer in my country is increasing year by year, and has surpassed lung cancer to become the most common malignant tumor among women in my country. Every year, 270,000 new breast cancer patients are diagnosed, and nearly 70,000 people die from the disease. Clinically, according to the expression of estrogen receptor (estrogen receptor, ER), progesterone receptor (progesterone receptor, PR), human epidermal growth factor receptor 2 (human epidermal growth factor receptor 2, HER2) and Ki67 in breast cancer tissue The status is divided into different...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): A61K31/713A61P35/00
CPCA61K31/713A61P35/00
Inventor 陈念永
Owner WEST CHINA HOSPITAL SICHUAN UNIV
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More