Method for producing 2'-fucosyllactose by using escherichia coli

A technology of fucosyllactose and Escherichia coli, which is applied in the field of microorganisms and can solve the problems of low efficiency of 2'-fucosyllactose

Active Publication Date: 2020-06-02
SHANGHAI ADVANCED RES INST CHINESE ACADEMY OF SCI
View PDF7 Cites 7 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Designed to solve the problem of low efficiency of 2’-fucosyllactose secretion by existing E. coli species

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Method for producing 2'-fucosyllactose by using escherichia coli
  • Method for producing 2'-fucosyllactose by using escherichia coli
  • Method for producing 2'-fucosyllactose by using escherichia coli

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0051] 1. Knockout method

[0052] Through the NCBI genome database, the operon sequence of Escherichia coli colanic acid was obtained, and PCR primers were designed. Using the bacterial liquid of Escherichia coli S17-3 as a template, the upstream and downstream of the wcaJ gene shown in SEQ ID NO. Each sequence was amplified by 300bp to obtain adjacent homology arm DNA of wcaJ. The primers for amplifying upstream homologous fragments are:

[0053] Ant-F:AGCGGTGAGATCAACAGCAAACTGG (SEQ ID NO.8), and

[0054] Ant-R:TAGGAACTTCGAAGCAGCTCCAGCCTACACAATCGCTCCGTTGTTCCTGTTATTAGCCCCTTACCCG (SEQ ID NO.9), the PCR reaction system for amplifying the upstream homology arm fragment by primer pair Ant-F, Ant-R is as follows:

[0055]

[0056] The PCR program is as follows:

[0057] 1) 95°C, 3min;

[0058] 2) 95°C, 15sec;

[0059] 3) 56°C, 15sec;

[0060] 4) 72°C, 2.5min;

[0061] 5) Cycle from 2) to 4), 30 times;

[0062] 6) 72°C, 5min;

[0063] 7) Store at 4°C.

[0064] Similarl...

Embodiment 2

[0086] Embodiment 2: Construction of recombinant plasmid pMK4-pxylA-FutC

[0087] First, the expression element of the vector was obtained from the plasmid pMK4-pxylA-GFP stored in the laboratory by PCR amplification, and the amplification primers were:

[0088] pMK4-F:ATGAATTCACTGGCCGTCGTTTTACAAC (SEQ ID NO. 3)

[0089] pMK4-R: TTTTTATTCCTCCTTGTTCCCGGGTTGATT (SEQ ID NO. 4)

[0090] The PCR reaction system of the pMK4 expression element of the amplified fragment pMK4 by the primer pair pMK4-F, pMK4-R is as follows:

[0091]

[0092] The PCR program is as follows:

[0093] 1) 95°C, 3min;

[0094] 2) 95°C, 15sec;

[0095] 3) 56°C, 15sec;

[0096] 4) 72°C, 2.5min;

[0097] 5) Cycle from 2) to 4), 30 times;

[0098] 6) 72°C, 5min;

[0099] 7) Store at 4°C.

[0100]Nucleotide sequences related to the expression of fucosyltransferase FutC were generated by Jinweizhi Biotechnology Company using DNA chemical synthesis and constructed into the cloning vector pUC19.

[0101...

Embodiment 3

[0105] Example 3: Fermentative production of 2'-fucosyllactose by recombinant Escherichia coli under initial low pH conditions

[0106] Use the recombinant Escherichia coli mentioned above as the production strain for shake flask fermentation: Pick the recombinant Escherichia coli with an inoculation loop and inoculate it into a test tube containing 3 ml of LB, culture overnight at 37°C on a shaker at 200r / min. Inoculate the Escherichia coli overnight cultured with 1% inoculum into a 500mL shake flask containing 50mL liquid LB medium, add 10g / L lactose, 20g / L glycerol and 50ul of 100ug / ml ampicillin Antibiotics were also fermented at 37°C and 200r / min in a shaker. The initial pH of the medium was controlled at pH 4.5 using 3M hydrochloric acid. The shake flask was fermented continuously for 96 hours, and the 2'-FL production was measured by taking samples at intervals of 12 hours.

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses use of Escherichia coli S17-3 for the production of 2'-fucosyllactose. The preservation number of the Escherichia coli S17-3 is CCTCC 2018200. The Escherichia coli S17-3 with high yield of colanicacid is used for denovo synthesizing of 2'-fucosyllactose by using lactose as a sole substrate, and no synthetic route for exogenously expressing GDP-L-fucose exists. According toa fermentation method of recombinant escherichia coli for producing 2'-fucosyllactose, the fermentation output is increased by more than 10 times, the highest output reaches 617.0 mg / L, and the outputis greatly increased.

Description

technical field [0001] The invention belongs to the field of microorganisms, and in particular relates to a method for producing 2'-fucosyllactose by using Escherichia coli. Background technique [0002] In recent years, many studies have shown that human milk oligosaccharides (HMOs) have several positive effects on the healthy growth of infants by resisting gastrointestinal pathogenic microorganism infection and maintaining the microecological balance of gastrointestinal tract. Compared with other mammalian milks, human milk has many unique oligosaccharides that can provide various biological activities for human health, such as prebiotic effect, prevention of pathogen infection and immune system regulation. According to literature reports, 2'-fucosyllactose (2'-FL) is one of the main human milk oligosaccharides involved in biological functions as mentioned above, which makes this functional oligosaccharide extremely attractive in nutritional health care and pharmaceutical ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): C12P19/00C12P19/18C12N1/21C12N15/54C12N15/70C12R1/19
CPCC12P19/00C12P19/18C12N9/1051C12N15/70Y02A50/30
Inventor孙俊松陈桥史吉平谢雨康
OwnerSHANGHAI ADVANCED RES INST CHINESE ACADEMY OF SCI