Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Detection kit for copy numbers of SMN1 and SMN2 genes

A technology for gene copy number and primer detection, which is applied in the determination/inspection of microorganisms, DNA/RNA fragments, recombinant DNA technology, etc. The effect of improving detection specificity, simple operation and high detection sensitivity

Active Publication Date: 2020-06-02
XIAMEN BIOFAST BIOTECHNOLOGY CO LTD
View PDF5 Cites 7 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, the test results have a high chance of false positives and false negatives. It is no problem for disease diagnosis, but the detection stability for carriers is not high. Currently, there is no forensic reagent for simultaneous detection of SMN1 and SMN2 on the market.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Detection kit for copy numbers of SMN1 and SMN2 genes
  • Detection kit for copy numbers of SMN1 and SMN2 genes
  • Detection kit for copy numbers of SMN1 and SMN2 genes

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0053] 1. Preparation of SMA reaction solution and SMA primer mixture

[0054] Table 1 SMA reaction solution component preparation list

[0055]

[0056] Table 2 SMA primer mixture component preparation table

[0057]

[0058] * ACTB upstream primer sequence:

[0059] TGACCGTCTGCGCCTCGTTCCATGTACGTTGCTATCCAGGC,

[0060] ACTB downstream primer sequence:

[0061] TCGACGCACGCTCCTGCTACAGCTCATTGCCAATGGTGATGAC,

[0062] HBB upstream primer sequence:

[0063] TGACCGTCTGCGCCTCGTTCACACAACTGTGTTCACTAGC,

[0064] HBB downstream primer sequence:

[0065] TCGACGCACGCTCCTGCTACATGGTCTCCTTAAACCTGTCTTG.

Embodiment 2

[0066] Embodiment 2 PCR amplification and result analysis

[0067] 1. Sample processing: Nucleic acid extractor (MagCore) and nucleic acid extraction kit (MagCore Genomic DNAWholeBlood Kit) extract human genomic DNA for subsequent PCR reaction, the DNA concentration is 2.5ng / uL~60ng / uL, the ratio of OD260nm / OD280nm Between 1.6-2.0.

[0068] 2. Preparation of amplification reagents:

[0069] (1) Take out the SMA reaction solution and SMA primer mixture from the kit, thaw at room temperature, mix them upside down, and centrifuge briefly with a microcentrifuge to make all the liquid settle to the bottom of the tube.

[0070] (2) Preparation of amplification reagents: prepare amplification reagents as shown in Table 3

[0071] Table 3 Amplification reagent preparation table

[0072]

[0073] * In order to reduce the separation error, it is recommended to take (n+1) parts of reaction solution and mixed enzyme according to the number of samples (n) when preparing amplification...

Embodiment 3

[0089] Example 3 Reagent Performance Verification

[0090] 1. Preparation of SMA normal control

[0091] The 7th exon plasmid of SMN1 of 2 copy numbers, the 7th exon plasmid of SMN2 of 2 copy numbers, the 8th exon plasmid of SMN1 of 2 copy numbers, the 8th exon plasmid of SMN2 of 2 copy numbers, 2 The copy number of ACTB plasmid and the 2 copy number of HBB plasmid were respectively mixed in equal proportions, and the final concentration was 14500 copies / μL.

[0092] 2. Conformity rate of missing reference products

[0093] Detect 4 copies of missing reference products, as shown in the following table, respectively detect high, medium and low concentrations, the concentrations are 60 ng / uL, 25 ng / uL, 5 ng / uL respectively, and perform three repeated tests at each concentration, test three batches of reagents, and test results The positive coincidence rate was 100%.

[0094] Table 5 Gene copy numbers of exon 7 and exon 8 of deletion reference SMN1 and SMN2

[0095]

[009...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to the field of molecular biology diagnosis, in particular to a detection kit for copy numbers of SMN1 and SMN2 genes. A seventh exon of SMN1, an eighth exon of SMN1, a seventh exon of SMN2 and an eighth exon of SMN2 are amplified simultaneously in a one-tube PRC reaction solution by using eight primers, meanwhile, one or two groups of housekeeping genes are used to monitor the PCR reaction efficiency, PCR products are analyzed by capillary electrophoresis and calculated according to an SMN normal control with 2 copy numbers of SMN1 and SMN2 genes, relatively quantitativedetection is performed on the cop numbers of the SMN1 and SMN2 genes, SMN1 and SMN2 genes with 0, 1, 2, 3 equal to or larger than 4 copy numbers are calculated, and SMA patients, carriers and normalpersons are distinguished. Results can be obtained within 3 h starting from DNA samples, the copy number conditions of the SMN1 and SMN2 genes can be detected only through one PCR experiment, the detection technical process is simple, and standardization is easy to realize.

Description

technical field [0001] The invention relates to the field of molecular biology diagnosis, in particular to a detection kit for SMN1 and SMN2 gene copy numbers. Background technique [0002] Spinal muscular atrophy (SMA) is a disease in which degeneration of motor neurons in the anterior horn of the spinal cord leads to muscle weakness, muscle atrophy and paralysis. ), Type III (mild) and Type IV (adult). General neurologists make a clinical diagnosis based on the age of onset, clinical manifestations, and degree of disease progression. Auxiliary examination methods include electromyography, muscle enzymes, and muscle biopsy. Combined with family history and SMN1 gene analysis, the diagnosis can be made. SMA type Ⅰ is the most severe subtype, with onset within 6 months of birth, and the general survival period is within 2 years; SMA type Ⅱ is the moderate type, with onset in patients usually within 6 to 18 months, and the survival period is less than 2 years. Relying on ext...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12Q1/6883C12Q1/686C12N15/11
CPCC12Q1/6883C12Q1/686C12Q2600/156C12Q2545/114C12Q2600/16C12Q2600/158
Inventor 郭亦亦邱一帆钟丽霞李淑如
Owner XIAMEN BIOFAST BIOTECHNOLOGY CO LTD
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com