Method and primer for detecting copy number of recombinant human nerve growth factor gene

A gene copy number and growth factor technology, applied in biochemical equipment and methods, recombinant DNA technology, microbial measurement/inspection, etc., to achieve highly specific effects

Inactive Publication Date: 2020-05-29
BEIJING HUAAN INNOVATION BIOTECH
View PDF6 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Currently, there is no real-time PCR detection method for NGF gene copy number in CHO cells

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Method and primer for detecting copy number of recombinant human nerve growth factor gene
  • Method and primer for detecting copy number of recombinant human nerve growth factor gene
  • Method and primer for detecting copy number of recombinant human nerve growth factor gene

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0039] The establishment of the detection method of recombinant human nerve growth factor (NGF) gene copy number in embodiment 1.CHO cell

[0040] 1. Experimental materials

[0041] (1) NGF expression vector pOptiVEC-TOPO-NGF118

[0042] The vector pOptiVEC-TOPO-NGF118 was constructed and preserved by our company, in which the DNA sequence of the NGF target gene used to construct the vector is:

[0043] TCTAGAAGCGTAATGTCCATGTTGTTCTACACTCTGATCACAGCTTTTCTGATCGGCATACAGGCGGAACCACACTCAGAGAGCAATGTCCCAGCAGGACACACCATCCCCCAAGCCCACTGGACTAAACTTCAGCATTCCCTTGACACTGCCCTTCGCAGAGCCCGCAGCGCCCCGGCAGCGGTGATAGCTGCACGCGTGGCGGGGCAGACCCGCAACATTACTGTGGACCACAGGCTGTTTAAAAAGCGGCGACTCCGTTCACCCCGTGTGCTGTTTAGCACCCAGCCTCCCCGTGAAGCCGCAGACACTCAGGATCTGGACTTCGAGGTCGGTGGTGCTGCCCCCTTCAACAGGACTCACAGGAGCAAGCGGTCATCATCCCATCCCATCAACCACAGGGGCGAGTTCTCGGTGTGTGACAGTGTCAGCGTGTGGGTTGGGGATAAGACCACCGCCACAGACATCAAGGGCAAGGAGGTGATGGTGTTGGGAGAGGTGAACATTAACAACAGTGTATTCAAACAGTACTTTTTTGAGACCAAGTGCCGGGACCCAAATCCCGTTGACAGCGGGTGCCGGGG...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

No PUM Login to view more

Abstract

The invention relates to the technical field of gene detection and particularly relates to a method and primer for detecting a copy number of a recombinant human nerve growth factor gene. The primer comprises a primer pair represented by sequences 1 and 2 in a sequence listing. The method comprises the steps: carrying out fluorescent quantitative PCR on a target gene of a cell sample by adopting the primer, meanwhile, carrying out fluorescent quantitative PCR on an internal reference gene, and substituting respective Cq values into respective standard curves separately so as to obtain a copy number of the target gene and a copy number of the internal reference gene, wherein a ratio of the copy number of the target gene to the copy number of the internal reference gene is the copy number ofthe recombinant human nerve growth factor gene of the sample. The method is high in specificity and high in sensitivity, is simple, convenient and rapid and contributes to evaluation on stability ofthe recombinant human nerve growth factor gene of a cell bank during passage.

Description

technical field [0001] The invention relates to the technical field of gene detection, in particular to a method and primers for detecting the copy number of recombinant human nerve growth factor (NGF) gene in cells. Background technique [0002] Nerve growth factor (NGF) is the first discovered neurotrophic factor, which plays an important role in the growth, development, differentiation, survival and repair of damaged nerve cells. At present, NGF extracted from rat submandibular gland is clinically used for the repair of various nerve injuries, and the curative effect is remarkable. Compared with mouse nerve growth factor (mNGF), recombinant human nerve growth factor (rhNGF) expressed by Chinese hamster ovary cells (CHO cells) has higher activity and lower immune risk, and has broad market prospects. [0003] Chinese hamster ovary (CHO) cells are mainly used for the expression of recombinant proteins. In 1984, Genentech realized for the first time the expression of tissu...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
Patent Type & Authority Applications(China)
IPC IPC(8): C12Q1/6851C12N15/11
CPCC12Q1/6851C12Q2531/113C12Q2537/16C12Q2545/114C12Q2545/101C12Q2563/107
Inventor 赵泽坤邵军超史权威
Owner BEIJING HUAAN INNOVATION BIOTECH
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap