Method and primer for detecting copy number of recombinant human nerve growth factor gene
A gene copy number and growth factor technology, applied in biochemical equipment and methods, recombinant DNA technology, microbial measurement/inspection, etc., to achieve highly specific effects
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0039] The establishment of the detection method of recombinant human nerve growth factor (NGF) gene copy number in embodiment 1.CHO cell
[0040] 1. Experimental materials
[0041] (1) NGF expression vector pOptiVEC-TOPO-NGF118
[0042] The vector pOptiVEC-TOPO-NGF118 was constructed and preserved by our company, in which the DNA sequence of the NGF target gene used to construct the vector is:
[0043] TCTAGAAGCGTAATGTCCATGTTGTTCTACACTCTGATCACAGCTTTTCTGATCGGCATACAGGCGGAACCACACTCAGAGAGCAATGTCCCAGCAGGACACACCATCCCCCAAGCCCACTGGACTAAACTTCAGCATTCCCTTGACACTGCCCTTCGCAGAGCCCGCAGCGCCCCGGCAGCGGTGATAGCTGCACGCGTGGCGGGGCAGACCCGCAACATTACTGTGGACCACAGGCTGTTTAAAAAGCGGCGACTCCGTTCACCCCGTGTGCTGTTTAGCACCCAGCCTCCCCGTGAAGCCGCAGACACTCAGGATCTGGACTTCGAGGTCGGTGGTGCTGCCCCCTTCAACAGGACTCACAGGAGCAAGCGGTCATCATCCCATCCCATCAACCACAGGGGCGAGTTCTCGGTGTGTGACAGTGTCAGCGTGTGGGTTGGGGATAAGACCACCGCCACAGACATCAAGGGCAAGGAGGTGATGGTGTTGGGAGAGGTGAACATTAACAACAGTGTATTCAAACAGTACTTTTTTGAGACCAAGTGCCGGGACCCAAATCCCGTTGACAGCGGGTGCCGGGG...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More - R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com



