Real-time fluorescent quantitative identification method of Tilletia controversa Kuhn, and kit thereof

A real-time fluorescent quantitative and identification method technology, applied in the field of real-time fluorescent quantitative identification of wheat smut, can solve the problems of small proportion, no signal amplification, low concentration, etc., and achieve the effect of avoiding interference and competition

Inactive Publication Date: 2015-07-15
INST OF PLANT PROTECTION CHINESE ACAD OF AGRI SCI
View PDF2 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

In 2004, Gao Qiang used RAPD technology to find a band that could distinguish Tilletia tritici and T. dwarf from other smut strains. No different bands were found between the bacteria, and the two could not be separated
However, the inventors found that the marker primers and PCR method in this patent could not be well applied to the early warning of wheat dwarf smut and the screening of TCK-resistant wheat varieties, probably because the extracted After DNA, the proportion of DNA in TCK is too small, that is, the concentration is too low, and the sensitivity of ordinary PCR is not enough to detect such a low concentration of templates
As we all know, real-time quantitative PCR is significantly superior to ordinary PCR in terms of sensitivity, so the inventors tried to use the Scar-labeled primers in real-time quantitative PCR to amplify TCK samples, but whether in real-time fluorescent quantitative methods or in TaqMan hydrolysis probe method In quantitative PCR, no signal can be amplified

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Real-time fluorescent quantitative identification method of Tilletia controversa Kuhn, and kit thereof
  • Real-time fluorescent quantitative identification method of Tilletia controversa Kuhn, and kit thereof
  • Real-time fluorescent quantitative identification method of Tilletia controversa Kuhn, and kit thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment Construction

[0036] 1. Experimental main reagents

[0037] Table I List of reagents used

[0038]

[0039] Unless otherwise specified, the reagents used in the present invention are commonly used reagents in the art.

[0040] 2. The main instruments of the experiment

[0041] Table II List of equipment used

[0042] equipment name Instrument model factory Vortex shaker QL-902 Haimen Qilin Bell Instrument Manufacturing Co., Ltd. centrifuge Centrifuge 5415D Eppendorf spectrophotometer NANODROP 2000 Therno scientific Fluorescent quantitative PCR instrument ABI7500 Applied Biosystems

[0043] 3. Experimental material of the present invention:

[0044] Five strains of T. controversa Kühn (TCK) came from the United States; two strains of T. foetida Liro (TFL) came from the Czech Republic, and the other 1 indivual country of originDifferent areas in the country were collected by the wheat disease group of the Institute of Plant Pr...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a real-time fluorescent quantitative identification method of Tilletia controversa Kuhn, and a kit thereof, and relates to a plant disease detection technology. The method comprises the following steps: obtaining the real-time quantitative standard curve of a TCK positive plasmid standard substance, wherein the Ct value is ordinate, and the initial template copy number is abscissa; 2, extracting the DNA of a sample to be measured; 3, carrying out a real-time fluorescent quantitative PCR reaction with the DNA of the sample to be measured as a template; and 4, obtaining the copy number of TCK in the sample to be measured according to the Ct value obtained through the real-time fluorescent quantitative PCR reaction and the real-time quantitative curve. Primers adopted by the real-time fluorescent quantitative PCR reaction comprise an upstream primer ACGACCGACTTTCCGAGAGC and a downstream primer GTGTGGGACGAAGGCATCAA. The invention also provides the kit based on the method.

Description

technical field [0001] The invention relates to a plant disease detection technology, in particular to a real-time fluorescence quantitative identification method for wheat smut (Tilletia controversa Kühn). Background technique [0002] Tilletia controversa Kühn (TCK for short) caused by Tilletia controversa Kühn (TCK) is an important international quarantine disease, which causes serious damage to wheat production and is also one of the main species of foreign biological invasion research in my country. One (Wang Yuan, 1997). In its popular year, the yield loss caused by wheat dwarf smut is generally 20% to 50%, and in severe cases it can reach 75% to 90%, or even extinction. The bacteria are highly resistant to stress, and their teliospores can survive in the soil for 3 to 7 years, and the teliospores wrapped in the galls can even maintain their vitality for more than 10 years. Once this disease occurs, it is difficult to control or eradicate it, so 15 countries in the wo...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): C12Q1/68C12Q1/04C12R1/645
CPCC12Q1/6895C12Q1/06C12Q1/6844
Inventor高利陈万权蔚慧欣刘太国刘博
OwnerINST OF PLANT PROTECTION CHINESE ACAD OF AGRI SCI