Factor VIII or factor ix gene knockout rabbit, method for preparing same and use thereof

A factor and gene technology, applied in the fields of biochemical equipment and methods, genetic engineering, DNA preparation, etc.

Pending Publication Date: 2020-08-04
GREEN CROSS CORP THE +1
View PDF2 Cites 4 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, to date there is no rabbit model of hemophilia using the CRISPR / Cas system

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Factor VIII or factor ix gene knockout rabbit, method for preparing same and use thereof
  • Factor VIII or factor ix gene knockout rabbit, method for preparing same and use thereof
  • Factor VIII or factor ix gene knockout rabbit, method for preparing same and use thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0096] Example 1. sgRNA design and CRISPR / Cas9 vector construction and in vitro transcription

[0097] 1-1 sgRNA design

[0098] In the case of Factor VIII, the sgRNA represented by the nucleotide sequences of SEQ ID NO:3 and SEQ ID NO:4 was designed using the sequence represented by the following SEQ ID NO:1 in the exon 1 region ( figure 1 ).

[0099] SEQ ID NO 1:

[0100] ATGCAAATAGAGCTCTCACCTGTTTCTTTGTGTGTATTTTACAATTGAGCTTTAGTGCCACCAGAAGATACTACCTGGGTGCAGTGAACTGTCCTGGGACTATATGCACAGTGAC CTGCTCAGTGA

[0101] SEQ ID NO 3: sgRNA 1 (+ strand)

[0102] 5'-GCCACCAGAGAGATACTACCTGGG-3'

[0103] SEQ ID NO 4: sgRNA 2 (-strand)

[0104] 5'-GTCACTGTGCATATAGTCCCAGG-3'

[0105] In the case of Factor IX, the sgRNA represented by the nucleotide sequences of SEQ ID NO:5 and SEQ ID NO:6 was designed using the sequence represented by the following SEQ ID NO:2 in the exon 2 region.

[0106] SEQ ID NO 2:

[0107] TTTTTCTTGATCATGAAAATGCCACCAAAATTCTGAATCGGGCAAAGAGGTACAATTCAGGTAAACTGGAAGAGTT...

Embodiment 2

[0120] Example 2. Injection of transcribed Cas9 / sgRNA into embryos

[0121] The Cas9 / FVIII sgRNA or Cas9 / FIX sgRNA obtained in Example 1 was introduced into fertilized rabbit eggs using a known method (Sci Rep.2016; 6:222024).

[0122] About 18 to 20 hours after fertilization, the rabbit fertilized eggs were transferred to embryo medium (9.5g TCM-119, 0.05g NaHCO 3 (Sigma, S4019), 0.75g Hepes (Sigma H3784), 0.05g penicillin, 0.06g streptomycin, 1.755gNaCl, 3.0g BSA and 1L Milli Q distilled water), FVIII sgRNA (25ng / μl) and Cas9 mRNA (100ng / μl) or FIX sgRNA (25ng / μl) and Cas9 mRNA (100ng / μl) were injected into the embryonic cytoplasm, and then the embryonic cytoplasm was incubated in the culture medium at 38.5°C under 5% carbon dioxide for 30 to 60 minutes, and then the embryos were Transplantation into surrogate mothers to produce rabbits.

Embodiment 3

[0123] Example 3. Genotype analysis of transgenic rabbits

[0124] 3-1. Genotype analysis of factor VIII knockout rabbits

[0125] figure 2 Amplicons shown in (a) were amplified using primers of SEQ ID NO: 9 and 10, using secondary and tertiary PCR to attach adapters and markers, using MiSeq (Illumina, MiSeq kit V) Deep sequencing, and using Cas analyzer to analyze the results (Bioinformatics, January 15, 2017; 333(2):286-288).

[0126] SEQ ID NO 9:F8-F

[0127] 5'-gagccatgcaaatagagctc-3'

[0128] SEQ ID NO 10:F8-R

[0129] 5'-atctttctccagccagagtc-3'

[0130] The results are shown in Table 1 and image 3 As shown in , indels were detected in the FVIII genes of subjects 2# and 3#.

[0131] [Table 1]

[0132]

[0133] In other words, a mutation deleting a 4 bp long nucleic acid fragment was detected in subject #2, which resulted in a premature stop codon and nonsense-mediated decay, thereby inhibiting gene expression. Mutations to delete 3bp and 12bp long nucleic ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

No PUM Login to view more

Abstract

The present invention relates to a factor VIII or factor IX gene knockout rabbit, a method for preparing the same and a use thereof and, more particularly, to a transgenic rabbit whose factor VIII orfactor IX gene has been knocked out through the CRISPR / Cas9 system, a method for preparing the same and a use thereof. According to the present invention, in the transgenic rabbit, whose factor VIII and / or factor IX gene has been knocked out, the functions of factor VIII and / or factor IX, which are proteins that perform critical functions for the development of hemophilia, are inhibited, such thatthe transgenic rabbit is useful for the development of hemophilia treatments.

Description

【Technical field】 [0001] The present invention relates to factor VIII or factor IX gene knockout rabbits, production methods and uses thereof. More specifically, the present invention relates to transgenic rabbits using the CRISPR / Cas9 system to knock out the gene of factor VIII or factor IX, its production method and its use. 【Background technique】 [0002] Coagulation is a complex and necessary process that occurs in response to vascular injury. This is accomplished by the formation of a thrombus, which stops the bleeding and begins to repair the damaged blood vessel; the damaged site is covered with fibrin and platelets (including the thrombus). The process begins almost immediately after injury. [0003] Two types of components are involved in the blood clotting process: cellular components called "platelets" and protein components called "clotting factors". Platelets immediately form a plug at the site of injury, which is called "primary hemostasis." Secondary hemos...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
Patent Type & Authority Applications(China)
IPC IPC(8): C12N15/85C12N15/10C12N15/113C12N9/22C12N9/10C12N9/64A01K67/027
CPCA01K67/027C12N9/10C12N9/22C12N9/64C12N15/10C12N15/113C12N15/85C12N2310/20C12N15/102A01K67/0275A01K2217/075A01K2227/107A01K2267/0306C12N15/8509C12N9/1044C12N9/644C12N2310/10A01K2217/15A01K2207/15A01K2217/052A01K2217/203
Inventor 金少罗郑明恩金民静曺胜贤黄成虎郭曦天李秀珉南铉子
Owner GREEN CROSS CORP THE
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap