A kind of monoclonal antibody and application thereof for neutralizing Epstein-Barr virus

A technology of Epstein-Barr virus and antibodies, applied in the fields of antibodies, applications, antiviral agents, etc., can solve problems such as the marketing of human monoclonal antibodies, and achieve the effect of reducing side effects

Active Publication Date: 2022-03-29
SUN YAT SEN UNIV CANCER CENT +1
View PDF7 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, there is still no human monoclonal antibody against EBV envelope glycoprotein on the market

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • A kind of monoclonal antibody and application thereof for neutralizing Epstein-Barr virus
  • A kind of monoclonal antibody and application thereof for neutralizing Epstein-Barr virus
  • A kind of monoclonal antibody and application thereof for neutralizing Epstein-Barr virus

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1E

[0046] Preparation of embodiment 1 EBV gH / gL recombinant protein

[0047] The gH / gL proteins play an important role in the process of EBV epithelial cells. Therefore, the inventor's research team chose gH / gL as the bait protein to screen the scFv library displayed on the surface of yeast, in order to obtain neutralizing antibodies that can block EBV infection.

[0048] Then, the genome of the EBV-M81 strain was selected as a template to amplify the sequences of gH and gL respectively, and link them together through a linker to improve the efficiency of protein purification.

[0049] The original sequence of gH before modification:

[0050] ATGCAGTTGCTCTGTGTTTTTTGCCTGGTGTTGCTATGGGAGGTGGGGGCTGCCAGCCTTAGCGAGGTTAAGCTGCACCTGGACATAGAGGGGCATGCTTCGCATTACACCATCCCATGGACCGAACTGATGGCAAAGGTCCCAGGCCTTAGCCCAGAGGCGCTGTGGAGAGAGGCAAATGTCACCGAAGATTTGGCGTCTATGCTTAACCGCTACAAGTTAATTTACAAGACGTCTGGTACCCTTGGTATTGCGCTGGCCGAGCCTGTCGATATCCCTGCTGTCTCTGAAGGATCCATGCAAGTGGATGCATCTAAGGTCCATCCCGGAGTCATTAGCGGC...

Embodiment 2

[0094] Example 2 Screening of Yeast Library

[0095] Using yeast library screening technology, obtain yeast positive clones that specifically bind to gH / gL protein.

[0096] (1) Materials and equipment

[0097] Yeast surface display human non-immune scFv library is the antibody heavy chain and light chain variable regions respectively amplified from 58 normal human spleen and lymph node lymphocytes, with 3 G in the middle 4 The S linker constructs two genes together on the yeast display vector, that is, successfully constructs the yeast surface display scFv library, and the library capacity of the library is 10 9 (The yeast surface display scFv library used in this experiment comes from Michael J. laboratory); Omega Yeast Plasmid Small Extraction Kit; Amp+ plate; LB medium; streptavidin-microbeads (miltenyi biotec); anti-biotin-microbeads (miltenyi biotec) ; streptavidin-APC (ebioscience); anti-biotin-PE (ebioscience); YPD medium; SDCAA medium; SDCAA plate; SGCAA medium; Yea...

Embodiment 3

[0101] Example 3 Sequencing and Expression Purification of Monoclonal Antibodies

[0102] (1) The human-derived scFv yeast positive clone that binds to gH / gL was screened in Example 2, the plasmid in the yeast was extracted, and the antibody gene was obtained by sequencing.

[0103] (2) Expression and purification of monoclonal antibodies. The screened antibody heavy chain variable region upstream and CMV fragment, downstream and human IgG1 constant region and poly A fragment were subjected to overlapping PCR to obtain a fragment that could express the complete heavy chain; the screened antibody light chain variable region The upstream and CMV fragments, the downstream and the light chain κ / λ constant region, and the poly A fragment were subjected to overlapping PCR to obtain fragments that could express the complete light chain. These two fragments were then constructed into the PMD18T (Takara) vector. The PMD18T plasmid containing the full-length sequence of the antibody h...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The present invention discloses an antibody against Epstein-Barr virus for the first time, which is composed of a light chain and a heavy chain. The heavy chain variable region of the heavy chain has three complementary regions CDR1, CDR2 and CDR3, and their amino acid sequences are respectively shown in SEQ ID NO .1-3, the light chain variable region of the light chain has 3 complementary regions CDR1', CDR2' and CDR3', the amino acid sequences of which are respectively as SEQ ID NO.4, GAS, SEQ ID NO.5 shown. The antibody can block EBV infection of epithelial cells with an IC50 of 53ng / ml, but has no neutralizing effect on Ebola virus infection, indicating that the antibody has a high ability to specifically neutralize EBV infection of epithelial cells.

Description

technical field [0001] The invention relates to the technical field of antibodies, more specifically, to a monoclonal antibody for neutralizing Epstein-Barr virus and its application. Background technique [0002] Epstein-Barr virus was first successfully cultivated and established from Burkitt lymphoma cells by Epstein and Barr in 1964. EBV belongs to the gamma subtype herpes virus and is the first human cancer-causing virus discovered. EBV infection is very common in the population, it is reported that more than 95% of adults in the world carry EBV. In children and adolescents, EBV infection frequently causes infectious mononucleosis. EBV latent infection is related to the occurrence of various human lymphoid tumors and epithelial tumors, such as Hodgkin's lymphoma, Burkitt's lymphoma and NK / T cell lymphoma, etc. Epithelial tumors include nasopharyngeal carcinoma and about 10% of gastric cancer, etc. . For organ transplant patients and immunosuppressed patients such as...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityPatents(China)
IPC IPC(8): C07K16/08C12N15/13A61K39/42A61P31/22
CPCC07K16/085A61P31/22C07K2317/565C07K2317/56C07K2317/76
Inventor曾木圣张林琦朱倩莹梁清泰左亚男
OwnerSUN YAT SEN UNIV CANCER CENT