Unlock instant, AI-driven research and patent intelligence for your innovation.
Method for reversible protection and separation of DNA
What is Al technical title?
Al technical title is built by PatSnap Al team. It summarizes the technical point description of the patent document.
A DNA molecule, adenylation technology, applied in the field of molecular biology and biomedicine, can solve the problems of low resolution, high background, low accuracy, etc., and achieve the effect of high resolution, easy operation and high accuracy
Active Publication Date: 2020-09-22
QUFU NORMAL UNIV
View PDF9 Cites 0 Cited by
Summary
Abstract
Description
Claims
Application Information
AI Technical Summary
This helps you quickly interpret patents by identifying the three key elements:
Problems solved by technology
Method used
Benefits of technology
Problems solved by technology
[0006]
Aiming at the problems of high background, low resolution and low accuracy of the existing methods for detecting DNA damage, the present invention provides a method for DNA reversible protection and separation that can be used to detect DNA damage, which can locate DNA damage sites with high precision and can be applied Based on DNA samples of different lengths and different sources, the target DNA can be separated and analyzed at the single-molecule and single-nucleoside level
Method used
the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more
Image
Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
Click on the blue label to locate the original text in one second.
Reading with bidirectional positioning of images and text.
Smart Image
Examples
Experimental program
Comparison scheme
Effect test
Embodiment 1
[0039] Example 1 DNA adenylation modification and its anti-nuclease activity analysis
[0040] A 20 nt DNA single-stranded fragment containing 5' phosphorylation modification was synthesized by DNA Synthesis Company (IDT, USA), and the sequence is: / 5'Phos / -NNCAC TCG GGC ACC AAG GAC-3' and the same Sequence DNA.
[0041] Short DNA fragments containing phosphorylation modifications and non-modifications were mixed in equal proportions as DNA substrates. A 20 μL reaction system contained 100 pmol Mth RNA Ligase (NEB, USA), 2 μL 1 mM ATP (NEB, USA), 2 μL DNA Adenylation Buffer (NEB, USA), 2 μg DNA substrate, and made up 20 μL with water. After reacting at 65°C for 1.5 h, inactivate at 85°C for 5 min.
[0042]The reaction product was purified by DyeEx DNA Purification Kit 2.0 spin kit (QIAGEN), and then analyzed by Bioanalyzer (Agilent) Small RNA Chip. The result is as figure 2 Shown: Before the reaction, the phosphorylated DNA and the non-modified DNA could not be separated ...
Embodiment 2
[0045] Example 2 Application of adenylation reversible protection and separation technology in identifying DNA damage sites
[0046] 1. AP site
[0047] (1) A DNA double-stranded fragment containing 100 bp was synthesized by a DNA synthesis company (IDT Company, USA), and the positive-sense strand sequence was:
[0048] ACTGGGGCCAGATG U GTAAGCCCTCCCGTATCGTAGTTATCTACACGACGGGGAGTCAGGATTTCGTTCATCCATAGTTGCCTGACTCCCCGTCGTGTAG, DNA damage (Uracil) sites are underlined;
[0049] (2) Enzyme cutting DNA damage site: 50 μL reaction system contains: 10 units of Uracil repair enzyme UDG and endonuclease IV (NEB, USA), 5 μL buffer (NEB Cutsmart Buffer), 1 μg DNA substrate , make up 50 μL with water; react at 37°C for 1 hour, then inactivate at 75°C for 20 minutes;
[0050] (3) DNA denaturation: place the DNA sample in a PCR instrument, heat denature at 95°C for 3 minutes, and quickly place the sample on ice;
the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More
PUM
Login to View More
Abstract
The invention provides a method for reversible protection and separation of DNA. The method comprises the following steps that the 5' end of a target DNA molecule is phosphorylated; then the 5' end issubjected to adenylation modification; an exonuclease digestion template sensitive to adenylation modified DNA is added into a sample obtained after the reaction is ended; and finally, the obtained adenylation modification DNA, namely target DNA obtained by separation is subjected to sequencing identification and other technical analysis, and the obtained the 5' end of the sequence is an adenylation modification site. According to the method, the blank that the breaking sites on the genome DNA cannot be accurately positioned in the prior art is filled, quantitative and positioning analysis ofthe breaking sites of DNA samples with different lengths and different sources can be realized, and the method is simple and convenient to use, easy to operate, free of special requirements on the samples, high in accuracy, low in detection background influence and high in resolution ratio.
Description
technical field [0001] The invention belongs to the fields of molecular biology and biomedicine, and specifically relates to a method for reversibly protecting and separating DNA macromolecules. Background technique [0002] DNA molecules store the genetic information that organisms rely on to survive and reproduce, so maintaining the integrity of DNA is critical to cells. However, a variety of factors in the external environment and within the organism can cause damage or changes to DNA molecules, such as ultraviolet rays, radiation, carcinogenic chemicals, and oxidative stress generated during the cell's own metabolism. These lesions disrupt genome integrity and threaten genome stability. DNA damage is now widely accepted to be a major cause of cancer and many other age-related diseases, making it a very important issue for human health. [0003] Among the many types of DNA damage, strand breaks are recognized as the most harmful to cells, because strand breaks can block...
Claims
the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More
Application Information
Patent Timeline
Application Date:The date an application was filed.
Publication Date:The date a patent or application was officially published.
First Publication Date:The earliest publication date of a patent with the same application number.
Issue Date:Publication date of the patent grant document.
PCT Entry Date:The Entry date of PCT National Phase.
Estimated Expiry Date:The statutory expiry date of a patent right according to the Patent Law, and it is the longest term of protection that the patent right can achieve without the termination of the patent right due to other reasons(Term extension factor has been taken into account ).
Invalid Date:Actual expiry date is based on effective date or publication date of legal transaction data of invalid patent.
Login to View More 
Login to View More