Supercharge Your Innovation With Domain-Expert AI Agents!

Bemisia tabaci creb transcription factor and method for detecting resistance or sensitivity of bemisia tabaci to imidacloprid

A technology for Bemisia tabaci and imidacloprid, which is applied in the biological field and achieves the effects of accurate detection results and fast method operation.

Active Publication Date: 2022-04-12
INST OF VEGETABLE & FLOWERS CHINESE ACAD OF AGRI SCI
View PDF3 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, the research on the involvement of bemisia tabaci-related transcription factors in drug resistance is still blank

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Bemisia tabaci creb transcription factor and method for detecting resistance or sensitivity of bemisia tabaci to imidacloprid
  • Bemisia tabaci creb transcription factor and method for detecting resistance or sensitivity of bemisia tabaci to imidacloprid
  • Bemisia tabaci creb transcription factor and method for detecting resistance or sensitivity of bemisia tabaci to imidacloprid

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0030] Embodiment 1. CREB Gene full-length verification

[0031] Based on B. tabaci genome annotation information and transcriptome annotation, primer clones were designed CREB Gene sequences, primer sequences are shown in SEQ ID NO: 3 and SEQ ID NO: 4 (F: ATGGACGGGATGGTGGAGG; R: TCAATCTGTTTTTTGCTGGCAATAGAGC), compare the amino acid sequence differences and phylogeny of imidacloprid resistant strains after translation, and use genomic DNA information to carry out Gene structure analysis, clear CREB Characterization of genes in Bemisia tabaci.

[0032] The results showed that the CREB gene of B. tabaci had a full length of 849 bases (the sequence is shown in SEQ ID NO: 1), encoding 282 amino acids (the amino acid sequence is shown in SEQ ID NO: 2), and at the end there is a CREB family gene. A typical characteristic DNA-binding region (leucine zipper structure), further phylogenetic tree analysis showed that the gene belongs to a typical CREB family (such as figure 1 )....

Embodiment 2

[0034] (1) In allergy-resistant strains CERB Gene transcription level expression detection

[0035] design CREB Gene fluorescence quantitative PCR primers (F-ACTCAAGGCAGTCTCCAAACCC; RTTTCTGCTCCGCCTAAATCGTT) (amplification efficiency 99%) were used to detect the expression level of the adult worms of the resistant strains at the transcriptional level, and to compare and analyze the differences between the resistant and sensitive strains. Extracting RNA samples of two groups of adult worms, then reverse transcribing them into cDNA templates, and performing the reaction in a fluorescence quantitative PCR reaction system including the specific primers described in step 1;

[0036] (1) The extraction steps of B. tabaci adult RNA are as follows:

[0037] ①Take 30 adults of Bemisia tabaci from the sensitive and resistant populations, and freeze them in liquid nitrogen for future use;

[0038] ②Put the adult worms into a glass homogenizer, and add 1 ml of Trizol reagent to the ho...

Embodiment 3

[0071] Embodiment 3. Dual-luciferase reporter gene detection system

[0072] Analysis in Drosophila S2 cells using the Dual-Luciferase® Reporter Assay System, # E1980, Promega CYP6CM1 The upstream promoter sequence of the gene (the sequence is shown in SEQ ID NO: 5), and the transcription factor protein was overexpressed in S2 cells, and the transcription factor pair was analyzed. CYP6CM1 Activation and regulation of upstream regions of genes.

[0073] The Drosophila S2 cell line was donated to the laboratory of Chen Dahua, Institute of Zoology, Chinese Academy of Sciences. S2 cells were cultured in large petri dishes with a diameter of 15 cm in HyClone SFX medium in a CO-free medium 2 in a constant temperature incubator at 27°C.

[0074] S2 cells were transfected with liposome Lipofectamine 2000 (1ug / uL). Before transfection, cells with good growth status were taken, and the density reached 1.5~2.0×10 after dilution. 6 One, pipette an appropriate amount into the cell cu...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention belongs to the field of biotechnology, and specifically discloses the Bemisia tabaci CREB transcription factor, a coding gene, a recombinant vector, a recombinant cell line and a recombinant bacterial strain. Further, the present invention discloses a method for detecting the resistance or sensitivity of Bemisia tabaci to imidacloprid, which detects the phosphorylation level at position 111 of the amino acid sequence encoded by the CREB gene of Bemisia tabaci, and the used tobacco powder Antibody specific for phosphorylation at site 111 of lice CREB. The invention can quickly detect the resistance or sensitivity of the whitefly to imidacloprid, or the resistance level of the whitefly to imidacloprid in the field.

Description

technical field [0001] The invention belongs to the field of biotechnology, and particularly relates to a Bemisia tabaci CREB transcription factor, an encoded gene and a recombinant vector, a recombinant cell line, a recombinant strain, and a method for detecting the resistance or sensitivity of Bemisia tabaci to imidacloprid. Background technique [0002] Bemisia tabaci Bemisia tabaci (Gennadius) is a worldwide agricultural pest, and its damage mainly includes direct sucking of plant sap; transmission of plant viruses; secretion of honeydew leading to sooty disease, etc. The control of Bemisia tabaci is mainly based on chemical control. Because Bemisia tabaci is a small piercing and sucking insect, the entire developmental period includes egg stage, nymph stage and adult stage. Traditional contact insecticides such as bifenthrin, Avi Bacteriocin can effectively kill the adults of Bemisia tabaci, but cannot effectively kill the eggs and nymphs on the underside of leaves. N...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C07K14/435C12N15/12C07K16/18G01N33/53
CPCC07K14/43563C07K16/18G01N33/53
Inventor 张友军杨鑫吴青君王少丽徐宝云谢文郭兆将
Owner INST OF VEGETABLE & FLOWERS CHINESE ACAD OF AGRI SCI
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More