Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Construction and preparation of double-target chimeric antigen receptor T (CAR-T) of FLT3-NKG2D

A dual-target, inhibitor technology, applied in DNA/RNA fragments, recombinant DNA technology, medical preparations containing active ingredients, etc., can solve serious complications of CAR-T cells, loss of target antigen, and insignificant improvement, etc. question

Active Publication Date: 2020-10-23
ZHUJIANG HOSPITAL SOUTHERN MEDICAL UNIV
View PDF10 Cites 3 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0004] At present, most CAR-T cell designs are mainly aimed at lymphocytic leukemia such as CD19-CAR T cells. Single-target CAR-T cells are not effective enough to kill tumors, and super large doses of CAR-T cells are likely to cause serious complications. e.g. cytokine release syndrome (CRS)
Moreover, single-target CAR-T cell therapy is prone to loss of target antigen, leading to tumor recurrence after CAR-T cell therapy
[0005] Secondly, currently most FLT3 inhibitor monotherapy and single CAR-T cell therapy do not significantly improve the OS (overall survival time) of acute myeloid leukemia. For refractory FLT3 mut+ -AML did not produce a significant effect, and there is generally a lack of new anti-leukemia immune mechanisms with clinical therapeutic transformation significance to provide FLT3 mut+ -Treatment for AML patients brings new hope

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Construction and preparation of double-target chimeric antigen receptor T (CAR-T) of FLT3-NKG2D
  • Construction and preparation of double-target chimeric antigen receptor T (CAR-T) of FLT3-NKG2D
  • Construction and preparation of double-target chimeric antigen receptor T (CAR-T) of FLT3-NKG2D

Examples

Experimental program
Comparison scheme
Effect test

Embodiment Construction

[0036] In order to make the object, technical solution and technical effect of the present invention clearer, the present invention will be further described in detail below in conjunction with specific embodiments. It should be understood that the specific implementations described in this specification are only for explaining the present invention, not for limiting the present invention.

[0037] 1. Construction and identification of FLT3-NKG2D-CAR lentiviral vector

[0038] 1. Preparation and identification of lentiviral vector

[0039] 取FLT3(EB10)SCFV和NKG2D胞外区域基因序列,FLT3(EB10)SCFV具体序列为GATGTTGTGATGACTCAGTCTCCACTCTCCCTGCCCGTCACCCCTGGAGAGCCGGCCTCCATCTCCTGCAGGTCTAGTCAGAGCCTCCTGCATAGTAATGGAAACAACTATTTGGATTGGTACCTGCAGAAGCCAGGGCAGTCTCCACAGCTCCTGATCTATTTGGGTTCTAATCGGGCCTCTGGGGTCCCAGACAGATTCAGCGGCAGTGGGTCAGACACTGATTTCACACTGCAAATCAGTAGGGTGGAGGCTGAGGATGTTGGGGTTTATTACTGCATGCAAGGTACACACCCCGCCATCTCCTTCGGCCAAGGGACACGACTGGAGATTAAAGGTGGCGGAGGATCTGGCGGAGGTGGAAGCGGCGGAGGCGGATCTGAGGTCCAGCTGGTG...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses construction and preparation of double-target chimeric antigen receptor T (CAR-T) of FLT3-NKG2D. CAR of the invention belongs to double-target second-generation CAR, and has the functions of overcoming tumor immune escape and enhancing the specific recognition and killing of tumor cells. By combination of the double-target CAR-T and gilteritinib, the treatment dilemma of refractory acute myeloid leukemia of FLT3<mut+> can be effectively solved, and a new treatment strategy is provided for treatment of acute myeloid leukemia.

Description

technical field [0001] The invention relates to the field of biological immune cell therapy, in particular to the construction and preparation of FLT3-NKG2D dual-target CAR-T. Background technique [0002] In 2012, the annual meeting of the International Society for Cell Therapy pointed out that biological immune cell therapy has become the fourth means of tumor treatment besides surgery, radiotherapy, and chemotherapy, and will become a must-have means for future tumor treatment. Immune cell therapy is to collect peripheral venous blood from patients, isolate peripheral blood mononuclear cells in a GMP laboratory, and induce a large number of immune effector cells with high anti-tumor activity under the induction of various cytokines, and then through vein, intradermal Injection, intervention, etc. are reinfused into the patient's body to achieve the purpose of enhancing the patient's immune function and killing tumor cells. Commonly used immune cell therapy methods include...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12N5/10C12N15/867C12N15/62A61K39/00A61P35/02A61K31/64
CPCC12N5/0636C12N15/86C07K16/2863C07K14/7051C07K14/70578A61K39/001103A61P35/02A61K31/64C12N2510/00C12N2740/15043C12N2800/107C07K2317/622C07K2319/02C07K2319/03C07K2319/33C07K2319/74A61K2039/5156A61K2039/804A61K2300/00
Inventor 黄宇贤李可昕吴惠阳
Owner ZHUJIANG HOSPITAL SOUTHERN MEDICAL UNIV
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com