Modulators of irf4 expression

A nucleobase and oligonucleotide technology, applied in DNA/RNA fragments, medical preparations containing active ingredients, peptide/protein components, etc.

Pending Publication Date: 2020-11-03
IONIS PHARMA INC
View PDF99 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Despite its role in many cancers, IRF4 is considered undruggable by conventional therapies

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Modulators of irf4 expression
  • Modulators of irf4 expression
  • Modulators of irf4 expression

Examples

Experimental program
Comparison scheme
Effect test

Embodiment approach

[0112] Certain embodiments provide methods, compounds, and compositions for inhibiting IRF4 expression.

[0113] Certain embodiments provide compounds that target IRF4 nucleic acids. In certain embodiments, the IRF4 nucleic acid has the expression set forth in RefSeq or GENBANK Accession Nos. NM_002460.3 or NT_034880.3_TRUNC_328000_354000 (herein incorporated by reference, disclosed herein as SEQ ID NO: 1 and SEQ ID NO: 2, respectively). sequence. In certain embodiments, the compound is an antisense compound or an oligomeric compound. In certain embodiments, the compounds are single chain compounds. In certain embodiments, the compounds are double-stranded compounds.

[0114] Certain embodiments provide a kind of compound, it comprises the oligonucleotide of modification, the length of described oligonucleotide of modification is the nucleoside of 8 to 80 connections and has and comprises nucleobase sequence SEQ ID NO: A nucleobase sequence of at least 8 contiguous nucleob...

Embodiment 1

[0435] Example 1: Effect of 5-10-5 MOE spacer with phosphorothioate internucleoside linkage on human IRF4 in vitro, single dose

[0436] Modified oligonucleotides complementary to human IRF4 nucleic acid were designed and tested for their effect on IRF4 mRNA in vitro.

[0437] Using electroporation, cultured SK-MEL-28 cells were transfected at a density of 60,000 cells per well with the modified oligonucleotide at a concentration of 20,000 nM or no modified oligonucleotide for the untreated control. After approximately 24 hours, RNA was isolated from the cells and IRF4 mRNA levels were measured by quantitative real-time PCR. Human primer probe set RTS3114 (forward sequence AAGCCTTGGCGTTCTCAGACT, designated herein as SEQ ID NO: 3386; reverse sequence TCAGCTCCTTCACGAGGATTTC, herein designated as SEQ ID NO: 3387; probe sequence CCGGCTGCACATCTGCCTGTACTACC, herein designated as SEQ ID NO: 3387; ID NO:3388) was used to measure mRNA levels. According to as passed Measured total R...

Embodiment 2

[0444] Example 2: Effect of 3-10-3cEt spacer with phosphorothioate internucleoside linkage on human IRF4 in vitro, single dose

[0445] Modified oligonucleotides complementary to human IRF4 nucleic acid were designed and tested for their effect on IRF4 mRNA in vitro.

[0446] Using electroporation, cultured SK-MEL-28 cells were transfected at a density of 20,000 cells per well with the modified oligonucleotide at a concentration of 4,000 nM or no modified oligonucleotide for untreated controls. After approximately 24 hours, RNA was isolated from the cells and IRF4 mRNA levels were measured by quantitative real-time PCR. The human primer probe set RTS3114 (described herein above in Example 1) was used to measure mRNA levels. According to as passed Measured total RNA content regulates IRF4 mRNA levels. Results are shown in the table below as percent control relative to the amount of IRF4 mRNA of untreated control (UTC) cells.

[0447] The modified oligonucleotides in Tables...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
Viscosityaaaaaaaaaa
Login to View More

Abstract

The present embodiments provide methods, compounds, and compositions useful for inhibiting IRF4 expression, which may be useful for treating, preventing, or ameliorating a cancer associated with IRF4.

Description

[0001] sequence listing [0002] This application is filed together with a Sequence Listing in electronic format. The sequence listing is provided as a file created on January 14, 2019, 712 kb in size, and titled BIOL0332WOSEQ.txt. The information in the sequence listing in electronic format is incorporated herein by reference in its entirety. technical field [0003] Embodiments of the present invention provide methods, compounds and compositions useful for inhibiting the expression of IRF4, which can be used for treating, preventing or ameliorating cancers associated with IRF4. Background technique [0004] Interferon regulatory factor 4 (IRF4) is a transcription factor involved in the immune response in normal B and T cells and is strongly implicated in the development of hematological malignancies, especially multiple myeloma (MM). High IRF4 levels are associated with poor prognosis in overall survival of MM patients. Upregulation of the cereblon / IRF4 pathway leads to...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): A61K31/454A61K31/517A61K31/5377A61K38/21
CPCC12N15/113C12N2310/11C12N2310/315C12N2310/3231C12N2310/341C12N2310/344A61K31/7088A61K31/7115A61K31/712A61K31/7125A61K31/713C12N2310/321C12N2310/3525C07H21/00A61P35/00C12N15/111
Inventor周天元金英洙R·马克雷德H-H·布维苏珊·M·弗赖尔
OwnerIONIS PHARMA INC