A recombinant Escherichia coli producing isobutylamine and its construction method and application

A technology for recombining Escherichia coli and isobutylamine, applied in the biological field, can solve problems such as the high price of isobutylamine, the inability to synthesize isobutylamine alone, and the existence of by-products of diisobutylamine and triisobutylamine

Active Publication Date: 2021-12-03
TIANJIN INST OF IND BIOTECH CHINESE ACADEMY OF SCI
View PDF8 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Although the raw material cost of producing isobutylamine is not high, because the synthesis process of producing isobutylamine by amination of isobutanol is a chain type cascade reaction at present, it is impossible to synthesize isobutylamine alone in theory, and there are diisobutylamine, three Isobutylamine by-product
Leading to the high price of isobutylamine
The price of industrial-grade isobutylamine is about 30,000 yuan / ton, and the high price limits the wide application of isobutylamine
[0004] At present, there is no industrial strain that can be used to produce isobutylamine internationally and domestically

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • A recombinant Escherichia coli producing isobutylamine and its construction method and application
  • A recombinant Escherichia coli producing isobutylamine and its construction method and application

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0072] Embodiment 1, the selection of chassis bacteria

[0073] The performance of the chassis bacteria is very important. L-valine is the direct precursor of isobutylamine. It is necessary to construct a pathway for decarboxylation of L-valine to produce isobutylamine on a high-yield L-valine chassis bacteria. A high isobutylamine-producing strain.

[0074] Escherichia coli Sval031 is described in the patent application document with application number 202010466347.0. Escherichia coli Sval031 is a recombinant Escherichia coli that produces L-valine, with a yield of 82g / L and a transformation rate of 0.93mol 缬氨酸 / mol 葡萄糖 , almost no impurities, in line with industrial production requirements. In the present invention, Escherichia coli Sval031 is selected as the starting bacterium.

[0075] Escherichia coli (Escherichia coli) Sval031, has been preserved in the General Microbiology Center of the China Committee for Microbial Culture Collection (CGMCC for short) on March 6, 2...

Embodiment 2

[0076] Embodiment 2, the construction of recombinant escherichia coli ISO-001

[0077] 1. Amplification of VlmD insertion and constitutively expressed homologous recombination fragment

[0078] 1. Using the genomic DNA of the recombinant bacterium M1-93 as a template, PCR amplification was performed using a primer pair consisting of VlmD*kana frt up and VlmD*kana frtdown, and then the amplified product was recovered, and the obtained amplified product was named VlmD* 1. Amplification program: pre-denaturation at 98°C for 3 minutes; then denaturation at 98°C for 10 seconds, renaturation at 55°C for 30 seconds, extension at 72°C for 90 seconds, a total of 30 cycles; extension at 72°C for 10 minutes.

[0079] VlmD*kana frt up:

[0080] GTAACTCCGGGTTGATTTATGCTCGGAAATATTTGTTGTTGAGTTTTTTGTGTGTAGGCTGGAGCTGCTTC;

[0081] VlmD*kana frt down:

[0082] CTCGCGCTGCTGGTACTCATAGCTGTTTCCTGGTTTAAACGTAC.

[0083] In VlmD*1, the 1st-50th nucleotide is the upstream homology arm of one-step hom...

Embodiment 3

[0109] Embodiment 3, recombinant escherichia coli ISO-001 produces isobutylamine sulfate

[0110] 1. Preparation medium

[0111] Both the seed medium and the fermentation medium consisted of:

[0112] Macroelements: Glucose, (NH 4 ) 2 HPO 4 , NH 4 h 2 PO 4 , MgSO 4 ·7H 2 O;

[0113] Trace elements: FeCl 3 ·6H 2 O, CoCl 2 ·6H 2 O, CuCl 2 2H 2 O, ZnCl 2 、Na 2 MoO 4 2H 2 O, H 3 BO 3 and MnCl 2 4H 2 o 2 ;

[0114] water.

[0115] The same medium can be used for the seed medium and the fermentation medium.

[0116] The concentration of the above components in the culture medium can be respectively:

[0117] Macroelements: Glucose 50g / L-150g / L or 50g / L or 100g / L or 150g / L, NH 4 h 2 PO 4 0.5g / L-5g / L or 0.5g / L or 1g / L or 5g / L, (NH 4 ) 2 HPO 4 1g / L-10g / L or 1g / L or 3g / L or 10g / L, MgSO 4 ·7H 2 O 0.1g / L-5g / L or 0.1g / L or 1g / L or 5g / L;

[0118] Trace elements: FeCl 3 ·6H 2 O 0.2μg / L-5μg / or 0.2μg / L or 1.5μg / L or 5μg / L, CoCl 2 ·6H 2 O0.05μg / L-5μg / L ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a strain of recombinant Escherichia coli producing isobutylamine, its construction method and application. The inventors of the present invention used Escherichia coli Sval031 as the starting bacterium, integrated the gene encoding L-valine decarboxylase derived from Streptomyces viridifaciens into the starting bacterium, and used M1 by regulating the intensity of gene expression on the chromosome The ‑93 promoter increased the expression intensity of valine decarboxylase, and obtained the isobutylamine high-yielding strain ISO‑001. The isobutylamine production can reach 52.7g / L, and the conversion rate can reach 0.92mol / mol. In order to further improve the production efficiency of isobutylamine, the inventors of the present invention have optimized the expression intensity of the VlmD gene by using the RBS library control technology, and obtained the strain ISO-I with higher production efficiency of isobutylamine, and the output of isobutylamine has further improved. The increase of 66.4g / L. The invention realizes the industrial fermentation production of isobutylamine, and has very strong industrial application potential.

Description

technical field [0001] The invention belongs to the field of biotechnology, and relates to a recombinant Escherichia coli producing isobutylamine and its construction method and application. Background technique [0002] Isobutylamine is a low-level aliphatic primary amine, which has the basic properties of a low-level aliphatic primary amine, and is widely used in medicine, pesticide, cosmetics, petroleum, electronics and other industries. First of all, isobutylamine has rich chemical properties. It can be dehydrogenated to synthesize isobutyronitrile under the catalysis of zinc sulfate and used as a key raw material for the pesticide diazinon; it can also be used to synthesize antiviral drugs amprenavir, darunavir, Sanavir, imiquimod; can also be used in the synthesis of antibacterial drugs moxifloxacin hydrochloride, rifabutin; gastric drug leminoprazole; can also be used in the synthesis of cosmetic functional ingredients octanoyl isobutylamine, cinnamoyl isobutylamine ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityPatents(China)
IPC IPC(8): C12N1/21C12N15/70C12N9/88C12P13/00C12R1/19
CPCC12N9/88C12N15/70C12P13/001C12Y401/01014
Inventor张学礼于勇徐洪涛刘萍萍唐金磊
OwnerTIANJIN INST OF IND BIOTECH CHINESE ACADEMY OF SCI