A recombinant Escherichia coli producing isobutylamine and its construction method and application
A technology for recombining Escherichia coli and isobutylamine, applied in the biological field, can solve problems such as the high price of isobutylamine, the inability to synthesize isobutylamine alone, and the existence of by-products of diisobutylamine and triisobutylamine
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0072] Embodiment 1, the selection of chassis bacteria
[0073] The performance of the chassis bacteria is very important. L-valine is the direct precursor of isobutylamine. It is necessary to construct a pathway for decarboxylation of L-valine to produce isobutylamine on a high-yield L-valine chassis bacteria. A high isobutylamine-producing strain.
[0074] Escherichia coli Sval031 is described in the patent application document with application number 202010466347.0. Escherichia coli Sval031 is a recombinant Escherichia coli that produces L-valine, with a yield of 82g / L and a transformation rate of 0.93mol 缬氨酸 / mol 葡萄糖 , almost no impurities, in line with industrial production requirements. In the present invention, Escherichia coli Sval031 is selected as the starting bacterium.
[0075] Escherichia coli (Escherichia coli) Sval031, has been preserved in the General Microbiology Center of the China Committee for Microbial Culture Collection (CGMCC for short) on March 6, 2...
Embodiment 2
[0076] Embodiment 2, the construction of recombinant escherichia coli ISO-001
[0077] 1. Amplification of VlmD insertion and constitutively expressed homologous recombination fragment
[0078] 1. Using the genomic DNA of the recombinant bacterium M1-93 as a template, PCR amplification was performed using a primer pair consisting of VlmD*kana frt up and VlmD*kana frtdown, and then the amplified product was recovered, and the obtained amplified product was named VlmD* 1. Amplification program: pre-denaturation at 98°C for 3 minutes; then denaturation at 98°C for 10 seconds, renaturation at 55°C for 30 seconds, extension at 72°C for 90 seconds, a total of 30 cycles; extension at 72°C for 10 minutes.
[0079] VlmD*kana frt up:
[0080] GTAACTCCGGGTTGATTTATGCTCGGAAATATTTGTTGTTGAGTTTTTTGTGTGTAGGCTGGAGCTGCTTC;
[0081] VlmD*kana frt down:
[0082] CTCGCGCTGCTGGTACTCATAGCTGTTTCCTGGTTTAAACGTAC.
[0083] In VlmD*1, the 1st-50th nucleotide is the upstream homology arm of one-step hom...
Embodiment 3
[0109] Embodiment 3, recombinant escherichia coli ISO-001 produces isobutylamine sulfate
[0110] 1. Preparation medium
[0111] Both the seed medium and the fermentation medium consisted of:
[0112] Macroelements: Glucose, (NH 4 ) 2 HPO 4 , NH 4 h 2 PO 4 , MgSO 4 ·7H 2 O;
[0113] Trace elements: FeCl 3 ·6H 2 O, CoCl 2 ·6H 2 O, CuCl 2 2H 2 O, ZnCl 2 、Na 2 MoO 4 2H 2 O, H 3 BO 3 and MnCl 2 4H 2 o 2 ;
[0114] water.
[0115] The same medium can be used for the seed medium and the fermentation medium.
[0116] The concentration of the above components in the culture medium can be respectively:
[0117] Macroelements: Glucose 50g / L-150g / L or 50g / L or 100g / L or 150g / L, NH 4 h 2 PO 4 0.5g / L-5g / L or 0.5g / L or 1g / L or 5g / L, (NH 4 ) 2 HPO 4 1g / L-10g / L or 1g / L or 3g / L or 10g / L, MgSO 4 ·7H 2 O 0.1g / L-5g / L or 0.1g / L or 1g / L or 5g / L;
[0118] Trace elements: FeCl 3 ·6H 2 O 0.2μg / L-5μg / or 0.2μg / L or 1.5μg / L or 5μg / L, CoCl 2 ·6H 2 O0.05μg / L-5μg / L ...
PUM

Abstract
Description
Claims
Application Information

- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com