Allele related to selfing affinity of non-heading Chinese cabbage, and application thereof

A head cabbage and allele technology is applied in the field of genetic engineering, which can solve the problems of low reproductive efficiency of sterile lines, affecting the reproduction of breeding materials and seed production, and consuming manpower, so as to reduce the cost of seed production and improve the breeding efficiency. Effect

Active Publication Date: 2022-01-28
WUHAN ACADEMY OF AGRI SCI
View PDF10 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Due to the influence of self-incompatibility, the self-seed setting rate of non-heading Chinese cabbage is very low, which seriously affects the reproduction and seed production of breeding materials
In the breeding work, in order to breed inbred lines, technicians have to manually peel off the buds to save the inbred seeds, which consumes a lot of manpower
In the process of seed production, due to the influence of self-incompatibility, the reproductive efficiency of sterile lines is often very low

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Allele related to selfing affinity of non-heading Chinese cabbage, and application thereof
  • Allele related to selfing affinity of non-heading Chinese cabbage, and application thereof
  • Allele related to selfing affinity of non-heading Chinese cabbage, and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0029] Embodiment 1 Identification of self-compatibility gene

[0030] 1. Affinity pakchoi S haplotype identification

[0031] In the breeding population of Chinese cabbage, a pakchoi material with self-compatibility was selected and named "325". The results of aniline blue staining showed that a large amount of pollen germinated after self-pollination and the pollen tubes passed through the stigma-mastoid cells in bundles, showing a fully compatible phenotype ( figure 1 a). Seed setting experiments showed that the self-pollination siliques of this material developed normally and had a high seed setting rate ( figure 1 b). In order to understand the S haplotype of the material, the material was identified by PCR using the general primers of class I and class II S haplotypes of Chinese cabbage, such as figure 1 As shown in c, only class II S haplotype-specific primers can effectively amplify in the self-compatibility line "325". The above results indicated that "325" conta...

Embodiment 2

[0059] Application of embodiment 2 self-compatibility gene

[0060] 1. Development of molecular markers and parental and hybrid F 1 genotyping

[0061] Based on the sequence differences between the self-compatibility alleles BrSRK-325 and BrSCR-325 and other class II S-locus genes, specific molecular markers BrSRK325b-1043 and BrSCR325-152 were developed, with sizes of 1043bp and 152bp, respectively ( Figure 5 ). The primers for molecular markers are:

[0062] BrSRK325b-1F (SEQ ID No. 5): agcttggtttcttcaaaccctc;

[0063] BrSRK325b-1R (SEQ ID No. 6): caatactccatttcgaacatcagcc;

[0064] BrSCR325-1F (SEQ ID No. 7): gtgggacctcggatatgcccg;

[0065] BrSCR325-1R (SEQ ID No. 8): gtactcttcgaagaatccggagtg;

[0066] F 1 generation seeds. Extract hybrid F 1 The DNA of the generation plants was used to detect the S locus genotype of the plants using the developed molecular markers. 1 Successful detection in ( Figure 5 ). The above results indicated that the modified molecular...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

PropertyMeasurementUnit
lengthaaaaaaaaaa
Login to view more

Abstract

The invention relates to the technical field of gene engineering, and concretely relates to an allele related to selfing affinity of non-heading Chinese cabbage and application thereof. According to the invention, a non-heading Chinese cabbage material with self-compatibility is identified through phenotypic screening, and the new non-heading Chinese cabbage self-incompatibility locus allele is successfully separated by further adopting genetic analysis, gene cloning, expression analysis, sequence comparison analysis and other technical means. The gene can cause the non-heading Chinese cabbage to show thorough self-compatibility. The nucleotide sequences of the allele provided by the invention are as shown in SEQ ID No. 1 and SEQ ID No. 3. The invention further provides a molecular marker of the allele and application of the allele and the molecular marker. According to the obtained selfing affinity related allele, the breeding efficiency is greatly improved, and the seed production cost is reduced.

Description

technical field [0001] The invention relates to the technical field of genetic engineering, in particular to alleles related to self-compatibility traits of non-heading Chinese cabbage and applications thereof. Background technique [0002] The self-incompatibility (self-incompatibility, SI) of plants means that the stigma of the pistil can recognize its own pollen, so that its own pollen grains cannot germinate or the pollen tubes cannot elongate and grow, resulting in normal pollination or pollination failure. The phenomenon. Self-incompatibility plays an important role in preventing plant selfing decline, promoting outcrossing, and maintaining its genetic diversity. It is widely distributed in cruciferous vegetable crops (cabbage, cabbage, radish, broccoli, etc.). Self-incompatibility is genetically controlled by multiple alleles at the S locus (also called the S haplotype). In Brassica species, there are many kinds of S haplotypes. According to the sequence similarity ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
Patent Type & Authority Applications(China)
IPC IPC(8): C07K14/415C12N15/29C12Q1/6895C12N15/11A01H1/02A01H1/04
CPCC07K14/415C12Q1/6895A01H1/02A01H1/04C12Q2600/13C12Q2600/156C12Q2600/172
Inventor 高长斌汪爱华李兵张雪丽宋莉萍
Owner WUHAN ACADEMY OF AGRI SCI
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap