Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Specific primer pair for identifying processed auxiliary material turtle blood, kit and application

A technology of specificity and primer pairs, which is applied in biochemical equipment and methods, microbiological determination/inspection, DNA/RNA fragments, etc., to achieve the effect of long storage period, convenient means and strong subjectivity

Active Publication Date: 2022-06-28
NANJING UNIVERSITY OF TRADITIONAL CHINESE MEDICINE
View PDF1 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

At present, the polymerase chain reaction method (PCR) has been included in the 2020 edition of "Chinese Pharmacopoeia", and the current complete scientific identification method for the processed excipient turtle blood, especially in the molecular biology and biochemical characteristics of the processed excipient turtle blood There is still no basis to inquire, so it is an urgent task to establish characteristic identification methods in molecular biology and biochemistry of soft-shelled turtle blood products with high technology

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Specific primer pair for identifying processed auxiliary material turtle blood, kit and application
  • Specific primer pair for identifying processed auxiliary material turtle blood, kit and application
  • Specific primer pair for identifying processed auxiliary material turtle blood, kit and application

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0041] Example 1 Design of specific primer pairs

[0042]Using the CO I universal primer HCO2198 / LCO1490, a band of about 700 bp was amplified in 4 batches of processed soft-shelled turtle blood samples and successfully sequenced. According to the measured CO I sequence (as shown in SEQ ID NO: 1), all registered files were downloaded from NCBI. The Clustal W program was used for multiple sequence alignment of the CO I sequences of the turtle family and common animals, such as donkey, cattle, chicken, sheep, pig, and rabbit, to analyze the differential SNP sites. Three specific SNP sites were obtained from it, among which 306 is C (with GenBank sequence JF700184.1 as reference), 394 is G, and 520 is T, which are unique SNP sites of Chinese soft-shelled turtle, which can be used for processing soft-shelled turtle blood 4 pairs of Chinese soft-shelled turtle-specific identification primers were designed by Primer Premier 6, and based on ZHB1, ZHB2 was designed by introducing a mi...

Embodiment 2

[0052] Example 2 Optimization of PCR amplification conditions

[0053] The specific primer set obtained according to Example 1 and the T of the amplified product m The PCR reaction system and amplification program were set according to the value and length, and the PCR amplification was carried out with the genomic DNA of the processed turtle blood and the commonly used animal blood samples as the template. details as follows:

[0054] The PCR reaction system was 10 μL, genomic DNA extract was 100 ng; 2 × Rapid Taq Master Mix 5 μL; primer pairs (10 μM) for each of the forward and reverse sequences were 0.2 μL; double distilled water was added to 10 μL.

[0055] The PCR amplification procedure was pre-denaturation at 95°C for 3 min, denaturation at 95°C for 15 sec, annealing at 62°C for 15 sec, extension at 72°C for 15 sec, 29 amplification cycles, and thorough extension at 72°C for 3 min.

[0056] a. The PCR amplification procedures of the aforementioned set of PCR identific...

Embodiment 3

[0068] Example 3 Identification by PCR amplification test of soft-shelled turtle blood excipients and specific DNA sequences in whole blood of animals of different origins

[0069] (1)Material

[0070] a. Collect 12 batches of Chinese soft-shelled turtle blood samples in the Chinese soft-shelled turtle breeding base, each sample is about 30 mL; collect donkey blood, cow blood, chicken blood, sheep blood, pig blood, and rabbit blood samples in Xinyi and Nanjing, Jiangsu, each sample The sample was about 5 mL (see Table 1).

[0071] b. Reagents: agarose (Bio Froxx); Trans DNA Marker II (Beijing Quanzhijin Bio); 2× RapidTaq Master Mix (Nanjing Novi Biotechnology Co., Ltd.); FastPure Blood DNA Isolation Mini Kit V2 (Nanjing Novi Biotechnology Co., Ltd.) Zan Biotechnology Co., Ltd.); Ultra GelRed (1000×) (Nanjing Novizan Biotechnology Co., Ltd.); Tris-acetic acid electrophoresis buffer (50×TAE) (LEAGENE); primers are Shanghai Sangon Biotechnology Co., Ltd. synthesis.

[0072] c....

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to a specific primer pair and a kit for identifying processed auxiliary material turtle blood and application, the specific primer pair is composed of a forward primer and a reverse primer, and the nucleotide sequence of the forward primer is CTAGCAACCTAGCCCATGTG; and the nucleotide sequence of the reverse primer is GGATCTCCTCCTCCAGAAGG. The invention also provides application of the specific primer pair in turtle blood identification. The specific primer pair is good in specificity, only a polymerase chain reaction (PCR) amplification reaction needs to be carried out in a reaction system, the processing auxiliary material turtle blood and other animal blood can be rapidly and accurately identified only within 1 h, identification of the turtle blood and other animals can be achieved, and a perfect, objective, stable, accurate, scientific and reliable identification method is provided for the turtle blood.

Description

technical field [0001] The invention relates to the technical field of biological product identification and molecular labeling, in particular to a specific primer pair, a kit and application for identifying the processing auxiliary material turtle blood. Background technique [0002] The fresh blood of the soft-shelled turtle (Trionyx sinensis Wiegmann), a soft-shelled turtle, is widely recorded and used in traditional Chinese medicine because it has the functions of nourishing yin, clearing heat, promoting blood circulation and dredging collaterals. Through the textual research on the ancient books of herbal medicine, it is found that in addition to direct medicinal use, turtle blood is also a processed auxiliary material with traditional Chinese medicine characteristics. , mainly used for processing Bupleurum, Hu Huanglian, Coptidis, Artemisia annua, Licorice and other decoction pieces, and used in prescriptions, among which Turtle Blood Bupleurum decoction pieces are sti...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12Q1/6888C12N15/11C12Q1/686
CPCC12Q1/6888C12Q1/686C12Q2565/125
Inventor 陆兔林赵晓莉毛春芹毛靖许金国苏雪蓉谢颖娄悦
Owner NANJING UNIVERSITY OF TRADITIONAL CHINESE MEDICINE
Features
  • Generate Ideas
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More