Patents
Literature
Patsnap Eureka AI that helps you search prior art, draft patents, and assess FTO risks, powered by patent and scientific literature data.

31results about How to "Convenient means" patented technology

Method and device for measuring tunnel lining cracks

The invention relates to a method for measuring tunnel lining cracks. The method comprises the following steps of: acquiring an image of a crack by a digital camera and measuring the acquisition distance by a laser ranger; selecting an area needing to be measured from the acquired image so as to prevent processing deviation due to excessively big picture and relatively small target crack, and changing the selected area into a gray image; determining a threshold for the selected gray image and performing binarization image division to obtain a target area; extracting a white area only comprising the crack from the target area; extracting the border of the crack to obtain a border graph; calculating the pixel width of the crack by a minimum distance method; and obtaining the actual width of the crack according to a predetermined calibration proportion between the actual pixel size and the photographing distance. The method has the advantages of low cost, high speed, convenient carrying and high measurement precision.
Owner:SHANGHAI TONGYAN CIVIL ENGINEERING TECHNOLOGY CORP LTD

Tunnel lining crack width measuring method and device

The invention relates to a tunnel lining crack width measuring method, which comprises the follow steps of: (1) picking up crack images through a digital camera and measuring pickup distance through a laser distance measuring instrument; (2) selecting a region required to be measured on the picked images and converting selected region images into gray level images; (3) determining the threshold value of the gray level images selected in the second step, cutting binary image cutting, and obtaining a target region; (4) extracting a white region only comprising crack in the target region; (5) extracting the edge of the crack by a sub pixel method, and obtaining sub pixel level edge images; (6) circulating the pixel width of the crack by a minimum distance method; (7) circulating the actual width of the obtained crack according to the calibration proportion of the predetermined actual pixel size and the image pickup distance; and (8) storing the obtained actual width data into a crack data base. Compared with the prior art, the tunnel lining crack width measuring method has the advantages of low cost, high speed, convenience, high precision and the like.
Owner:TONGJI UNIV

Numerically-controlled machine tool thermal error on-line compensation method and system

The present invention discloses a numerically-controlled machine tool thermal error on-line compensation method and system. The numerically-controlled machine tool thermal error on-line compensation method comprises the steps of: acquiring key measuring point temperature data of a numerically-controlled machine tool; calculating a theoretical thermal error value of the numerically-controlled machine tool according to a multiple linear regression thermal error model; calculating a compensation value and judging whether the compensation value meets a set upper-lower limit range of a compensation threshold value. According to the numerically-controlled machine tool thermal error on-line compensation method, the multiple linear regression thermal error model is built and is used as a thermal error on-line compensation subunit of the numerically-controlled machine tool to be embedded into a human-computer interaction interface of a panel control unit, and an external compensator is not needed, thereby greatly improving universality of the system; at the same time, a fuzzy clustering analysis method and a multiple linear regression theory are used to calculate the compensation value of the numerically-controlled machine tool, and an external coordinate transformation mode is adopted for performing on-line compensation, thus convenient operation and good real-time performance are achieved.
Owner:UNIV OF ELECTRONIC SCI & TECH OF CHINA

Visual searching method applicable mobile terminal

The invention provides a visual searching method applicable a mobile terminal. The method comprises the concrete processes including the steps that 1, the mobile terminal is utilized for collecting images to be identified of the current scene, and in addition, the gravity direction of the mobile terminal during the image collection and the GPS (global position system) information of the current scene are obtained; 2, the binary local feature vectors of the images to be identified are obtained; 3, the GPS information and the binary local feature vectors are packed into a descriptor file, and the descriptor file is sent out; 4, images corresponding to the GPS information with the shortest distance from the extracted GPS information are extracted from a sample image base, and are defined as inquiry images; 5, the images to be identified are subjected to one-to-one matching with the binary local feature vectors of the inquiry images, the inquiry images with the shortest distance from the images to be identified are found, in addition, corresponding information is transmitted to the mobile terminal, and the visual searching is realized. The method can provide a more convenient measure for users of the mobile terminal to obtain relevant information of the current scene.
Owner:BEIJING INSTITUTE OF TECHNOLOGYGY

Operating environment safety monitoring and early warning system of meteorological equipment

The invention relates to an operating environment safety monitoring and early warning system of meteorological equipment, comprising one or a plurality of multi-element acquisition modules, a concentrator, and a monitoring and early warning terminal system, wherein the multi-element acquisition module is composed of an equipment networking server and a collector; the equipment networking server is connected with one or more of a hydrogen gas detector, a differential mercury vapor meter, a gauss meter or a dust measurement instrument; and the collector is connected with one or more of a temperature sensor, a humidity sensor, a voltage sensor or a smoke sensor. The use of the system in the invention can change the manual monitoring mode in the prior art, the monitoring mode is changed from passive to active, from dispersed to successive, and from post hoc analysis to real-time monitoring. A convenient and reliable means for the equipment guarantee and safety management of meteorological guarantee service departments at all levels can be provided, the management efficiency is improved, and the informatization level of equipment guarantee and management is improved. The system can be used as an auxiliary means and a platform of daily equipment guarantee and shift.
Owner:胡友彬 +4

Scene information searching method based on binary feature codes

The invention provides a scene information searching method based on binary feature codes, and belongs to the technical field of mobile augmented reality technologies. The scene information searching method specifically includes the steps of firstly, collecting an image to be recognized of a current scene, and obtaining GPS information and gravity direction information; secondly, obtaining a descriptor feature vector of the image to be recognized; thirdly, packaging the GPS information, the gravity direction information and the descriptor feature vector into a descriptor file, and sending the descriptor file to a server; fourthly, calculating the included angle between the main direction of the descriptor feature vector and the gravity direction of the descriptor feature vector through the server; fifthly, conducting mapping on the descriptor feature vector through the Hash function; sixthly, finding a corresponding GPS information chain table closest to the GPS information; seventhly, obtaining a Hash table set; eighthly, conducting filtering on the Hash table set based on the included angle; ninthly, finding the best matching sample image in the Hash table set which is filtered, and feeding the scene information corresponding to the sample image back to a mobile terminal.
Owner:BEIJING INSTITUTE OF TECHNOLOGYGY

Electrochemical measuring device and measuring method for bottom corrosion of rust layer of spoondrift splashing region

The invention discloses an electrochemical measuring device and a measuring method for bottom corrosion of a rust layer of a spoondrift splashing region. The electrochemical measuring device for the bottom corrosion of the rust layer of the spoondrift splashing region comprises a sealed dryer, an electrolytic tank, a working electrode, a reference electrode, an auxiliary electrode and mirror wiping paper. The device and the method can be used for measuring corrosion electrochemical behaviors in the spoondrift splashing region of a metal electrode covered by the rust layer, so that convenient and effective means are provided for a research process of the corrosion electrochemical behaviors under the rust layer of the spoondrift splashing region.
Owner:南通中国科学院海洋研究所海洋科学与技术研究发展中心 +1

Method for obtaining crude oil water content based on oil well indicator diagram

ActiveCN111475989AAvoid workloadAvoid hysteresisDesign optimisation/simulationOil fieldIndicator diagram
The invention belongs to the technical field of oil field oil extraction, and particularly relates to a method for obtaining crude oil water content based on an oil well indicator diagram. The methodcomprises seven steps of obtaining data in an indicator diagram, obtaining a suspension point static load value, obtaining a suspension point inertia load value, obtaining a suspension point vibrationload value, obtaining a friction load value, calculating the oil well moisture content and monitoring the crude oil moisture content. An existing digital oil well working condition diagnosis technology is utilized, the water content of an oil well is calculated in real time through a water content formula, the water content of the oil well is conveniently calculated and monitored, the labor intensity of field workers and investment of manpower, material resources and financial resources of an oil field are effectively reduced, and fine monitoring of oil well yield fluctuation of the oil fieldis achieved.
Owner:PETROCHINA CO LTD

Movable traffic information investigating instrument

InactiveCN101546477AImprove detection levelCommunication is flexible and convenientElectric signal transmission systemsDetection of traffic movementWireless transmissionEngineering
The invention discloses a movable traffic information investigating instrument which adopts a solar panel to absorb and store natural daylight energy and charge for a storage battery, and the storage battery provides power for the investigating instrument. The investigating instrument can adopt local storage or wireless transmission for collected traffic data, and can be mounted on an upright rod at one side of a road without an over-road portal frame or a cantilever rod body. The invention can evade a manual traffic flow investigation mode, has the advantages of simple and convenient installation, no need of taking commercial power, long-time storage of data, flexible and convenient communication, high detection precision and little investment, and can effectively improve the level of traffic detection of roads. The application of the invention can provide a scientific traffic flow investigating measure for road building, road alteration and traffic management.
Owner:刘业兴

Device and method for analyzing reliability of complex geotechnical project

The invention relates to a device and method for analyzing the reliability of a complex geotechnical project. The device comprises a center point switching module, a sampling point generating module, a sampling point rotating module, a finite element analyzing module, a reliability calculating module and a flow controlling module. The method includes the following steps: center point switching, sampling point generating, sampling point rotating, finite element analyzing, reliability calculating and flow controlling. Compared with the prior art, an improved response surface method solves the problems that an original response method is sensitive to step length values, the step length needs to be continuously and manually adjusted in the iterative process, and minus sampling points exist due to the excessively-large step length values, and a theoretical basis is provided for achieving automatic coupling calculation of reliability analysis and deterministic analysis in the complex geotechnical project; by means of the device and method, the workloads of reliability calculation of the complex geotechnical project can be reduced, and automatic coupling calculation of the reliability and the determinacy of the complex geotechnical project can be achieved.
Owner:TONGJI UNIV

Big data pressing extraction method

The invention discloses a big data pressing extraction method. The system comprises a big data cloud service center, a central control module, a customer group management module, an authority management module, a user terminal and a management terminal, wherein the customer group management module is used for collecting and storing personal information and identity characteristics of customers andcomparing and analyzing newly collected customer information with a customer storage database, and the authority management module is used for setting a data information reading authority level for data everyone and providing a data access password login platform and IP shielding. When the method is used, the abundant data information is provided for clients reaching the access authority for selection and extraction, a password access channel is provided for customers who cannot reach permission, and IP shielding is carried out on the customers who cannot log in, so that the information security of data owners is protected, the pertinence of data information putting is enhanced, and a more stable and convenient means is provided for seeking cooperation among enterprises.
Owner:GUANGZHOU FOCUSTAR TECH CO LTD

High-frequency composite electronic universal testing machine

The invention provides a high-frequency composite electronic universal testing machine, belongs to the technical field of testing machines, and aims to solve the problems of cumbersome operation, lowefficiency and low utilization rate of equipment in the prior art. The high-frequency composite electronic universal testing machine comprises a machine frame, a clamp, an electromagnetic high-frequency excitation mechanism, a conversion mechanism and a cage structure, wherein the machine frame at least comprises an upper beam and a lower beam which are oppositely arranged in the height directionand move in parallel relatively. The clamp is arranged between the upper beam and the lower beam, the clamp comprises an upper clamp and a lower clamp which are oppositely arranged in the height direction of the machine frame, and the lower clamp is fixedly connected with the lower beam. The electromagnetic high-frequency excitation mechanism is arranged on the upper beam, and the electromagnetichigh-frequency excitation mechanism penetrates through the upper beam through connecting columns and is fixedly connected with the upper clamp. The connecting columns relative to the upper beam are switched in a fixed state and a free state by the conversion mechanism. The upper clamp and the lower clamp are detachably connected to the two ends of the cage structure correspondingly.
Owner:长春浩园试验机有限公司

Theoretical line loss estimation method based on interrogation data

The invention discloses a theoretical line loss estimation method based on interrogation data. The method aims to solve the problems that a theoretical line loss calculation method in the prior art needs a large amount of data, has high data requirements, is complex and is not suitable for a production environment. The method comprises the following steps: S1, identifying a large-power user according to the daily power consumption of the user; s2, load interrogation is carried out, and power utilization data of a large-electric-quantity user and a terminal are obtained; and S3, calculating a theoretical line loss value according to the interrogation data. The theoretical line loss value is estimated simply and quickly with less data required by calculation, so that workers can know the line loss condition and the change trend preliminarily and conveniently, and the method is suitable for the production environment.
Owner:国网浙江海宁市供电有限公司

Monitoring and controlling processor based on wireless network low-power level signal and processing method

InactiveCN101442324ACancel noiseExcellent useful signalOpen water surveyTransmissionFiltrationGSM
The invention belongs to a monitoring processor used to extract a useful signal from high noise by being matched with a wireless router and so on in the remote monitoring and processing technique of a wireless network and a processing method thereof. The processor comprises a CPU, a communication module, a program read-write port module, a parallel communication module, an analog-digital conversion module, a constant current source module, a voltage transformation circuit, a signal filter and high voltage protection circuit, a signal amplifying module, a current signal adjusting circuit, a memory and a keyboard input circuit; and the method comprises: after the communication module receives a signal, firstly the threshold filtration of noise is performed, and the wavelet transformation processing of the signal is performed in the wavelet field through the CPU so as to reduce or completely eliminate the noise. Therefore, the processor and the method have the characteristics that the processor and the method can effectively extract the useful signal from a great amount of disorder noise signals, and automatically send the useful signal to a device such as a platform terminal and the like, and the point-to-point and one-to-many communications are realized; and the invention also provides a convenient and reliable method for mobile office work by utilizing the prior GSM network.
Owner:UNIV OF ELECTRONICS SCI & TECH OF CHINA

Phosphatization method for quenched steel plate production line for laboratory simulation of vehicles

The invention discloses a phosphatization method for a quenched steel plate production line for laboratory simulation of vehicles. The phosphatization method comprises the processes of pre-blanching,blanching, pre-degreasing, degreasing, primary washing with tap water, secondary washing with tap water, surface conditioning, phosphatization, tertiary washing with tap water, quaternary washing withtap water, primary washing with pure water, secondary washing with pure water, and air drying. In the process of phosphatization, the temperature is 35-45 DEG C, and the time is 2.5-3.5 min. The phosphatization method for the quenched steel plate production line for laboratory simulation of vehicles has the advantages that the phosphatization process is simple and convenient in operation, the operation can be completed without the need for higher phosphatization coating knowledge, and large-scale phosphatization experiment equipment does not need to be purchased so as to greatly save the cost.
Owner:TANGSHAN IRON & STEEL GROUP +1

Method for evaluating performance of monocrystalline high-temperature alloy in special environments

The invention discloses a method for evaluating performance of monocrystalline high-temperature alloy in special environments and belongs to the technical field of high-temperature alloy. The method includes: adopting a method of filling a heat-resistant glass tube with special gas to create environments with nitrogen and ammonia, and placing the processed monocrystalline high-temperature alloy in the environments; placing the whole device in a high-temperature furnace for thermal treatment, and cooling in air; using a common universal tension tester to test performance of the treated alloy. By adopting the method, influence on microstructure and tensile performance of nickel-based monocrystalline high-temperature alloy in the environments with high-temperature nitrogen and ammonia is evaluated successfully, and processing expense of especial equipment which is high in cost is avoided effectively. The method is simple, effective and suitable for being used to evaluate influence of special environments on material performance.
Owner:INST OF METAL RESEARCH - CHINESE ACAD OF SCI

Emulator of contact type intelligent card with USB interface

The invention discloses a simulator of contact intelligent card with USB interface, comprising a simulating chip and the supervising parts that controls the work of simulating chip. The simulator communicates with card reader through the USB interface, which has standard power line VDD and GND and signal line D+ and D-. The simulator has the own power source thereof which always supplies power to the simulating chip when the simulator is at work. User can control the simulator in the following ways: Control the connecting method of the signal line D+ and D- of USB interface with externally connected pull-up resistor through the supervising parts, and control the electrifying course of USB interface and its working mode of full speed or low speed. The supervising parts control the disconnecting of signal line D+ and D- of USB interface from the externally connected pull-up resistor and the pulling out course of simulating card from card reader. The invention can flexibly and conveniently set the connecting method of simulating chip's signal line D+ and D- with the external connected resistor by request, and simulate really the electrifying work course that is consistent with product and the regulation of agreement.
Owner:SHANGHAI HUAHONG INTEGRATED CIRCUIT

On-line Compensation Method and System for Thermal Error of CNC Machine Tool

The invention discloses an online compensation method and system for thermal error of a numerical control machine tool; collecting temperature data of key measuring points of the numerical control machine tool, calculating the theoretical thermal error value of the numerical control machine tool according to a multiple linear regression thermal error model, calculating the compensation value and judging whether the set value is satisfied Compensation threshold upper and lower limit range. The present invention builds a multivariate linear regression thermal error model, and embeds it as a thermal error online compensation subunit of a CNC machine tool into the human-computer interaction interface of the panel control unit, without requiring an external compensator, which greatly improves the versatility of the system; At the same time, the compensation value of CNC machine tools is calculated by using fuzzy cluster analysis method and multiple linear regression theory, and the external coordinate transformation method is used to perform online compensation, which is convenient and real-time.
Owner:UNIV OF ELECTRONICS SCI & TECH OF CHINA

Student canteen system

The invention discloses a student canteen system, and belongs to the technical field of canteens, the system comprises a student card and a mobile phone terminal. The student card and the mobile phoneterminal realize interaction through the intelligent canteen management system; the intelligent canteen management system comprises a reader and a message sending system. The reader is in signal connection with the information management system; the information management system is in signal connection with the message sending system; the student card is connected with the reader through the RFIDtechnology. The information management system realizes the functions of student account balance statistics, canteen remaining position calculation and dining time calculation; the information management system obtains intelligent dining information according to the functions, the message sending system transmits the intelligent dining information to the mobile phone terminal through the mobile communication technology, intelligent dining of students is achieved, the situation that the students have no dining seats and queue too long is effectively avoided, the system is scientific, reasonableand wide in application range, and a convenient means is provided for dining of the students.
Owner:北京智思迪科技有限公司

A complex geotechnical engineering reliability analysis device

The invention relates to a complex geotechnical engineering reliability analysis device. The device of the present invention includes a central point conversion module, a sampling point generation module, a sampling point rotation module, a finite element analysis module, a reliability calculation module and a process control module; the method of the present invention includes the following steps: a central point conversion step, a sampling point generation Step, sampling point rotation step, finite element analysis step, reliability calculation step and process control step. Compared with the prior art, the improved response surface method proposed by the present invention solves the problem that the old response method is sensitive to the value of the step size and needs to manually adjust the step size during the iterative process, and the negative number appears due to the value of the step size being too large The problem of sampling points provides a theoretical basis for the automatic coupling calculation of reliability analysis and deterministic analysis in complex geotechnical engineering; the invention can greatly reduce the workload of complex geotechnical engineering reliability calculation, and realize complex geotechnical engineering. Degree and deterministic automatic coupling calculation.
Owner:TONGJI UNIV

A research device and method for electrochemical corrosion behavior in spray splash zone

The invention relates to a research device and method for electrochemical corrosion behavior in a spray splash area, including a first guide rail support, a second guide rail support, an XY axis moving platform, a displacement sensor, an insulating cylinder, a high-precision digital display instrument, and a multi-channel data Recorder, platinum wire probe, working electrode, T-shaped electrode loading platform, bottom platform and container; the present invention uses a multi-channel data recorder to simultaneously record the change of displacement and the sudden change when the platinum wire probe contacts the liquid film and the working electrode respectively The voltage ensures the authenticity, accuracy and reliability of the data; the thickness of the thin liquid film can be adjusted by changing the relative position between the working electrode and the liquid surface, so that the thickness of the thin liquid film can be continuously adjusted, so that The corrosion behavior under the thin liquid film in the process of corrosion electrochemical behavior research provides a convenient and effective means; the operation is simple and the precision is high.
Owner:INST OF OCEANOLOGY - CHINESE ACAD OF SCI

A laboratory simulating phosphating method for the production line of quenched steel plates for automobiles

The invention discloses a phosphating method for simulating the production line of quenched steel plates for automobiles in a laboratory. The phosphating method includes pre-ironing, local ironing, pre-degreasing, local degreasing, tap water washing 1, tap water washing 2, surface conditioning, and phosphating , washing with tap water 3, washing with tap water 4, washing with pure water 1, washing with pure water 2 and air-drying process; in the phosphating process, the temperature is 35-45° C. and the time is 2.5-3.5 min. The laboratory simulates the phosphating method of the quenched steel plate production line for automobiles in the present invention. The phosphating process is easy to operate, and the operation can be completed without advanced phosphating coating knowledge, and there is no need to purchase large-scale phosphating experimental equipment, which saves a lot of cost.
Owner:TANGSHAN IRON & STEEL GROUP +1

Miniaturized simulator for maintenance of flaw detection machine

InactiveCN103869706AProper repair and disposalEasy to useSimulator controlControl powerMachine maintenance
The invention relates to a miniaturized simulator for maintenance of a flaw detection machine. The miniaturized simulator employs a power supply circuit, an oscilloscope, a control power supply, flaw detection machine power input, a pseudo MA power supply, true and false MA conversion, MA measurement, a pseudo load, true and false load conversion, a flaw detection machine controller and a flaw detection machine generator. The power supply circuit is respectively adaptively connected with the control power supply and the flaw detection machine power input; the control power supply is adaptively connected with the MA power supply; the pseudo MA power supply is adaptively connected with the true and false MA conversion; the true and false MA conversion is respectively adaptively connected with the oscilloscope, the MA measurement and the pseudo load; the flaw detection machine power input is adaptively connected with the flaw detection machine controller; the flaw detection machine controller and the flaw detection machine generator are adaptively connected with the true and false load conversion; the true and false load conversion is adaptively connected with the pseudo load; and an over-temperature test is adaptively connected with the flaw detection machine controller and the true and false load conversion. The miniaturized simulator provided by the invention has the advantages of reasonable structure, small size, convenient carrying, and high convenience and practicality, is suitable for professional flaw detection machine maintenance personnel to use, and helps the maintenance personnel to conveniently make a preliminary judgment about a flaw detection machine fault.
Owner:湖北省大冶市探伤机厂(普通合伙)

Monitoring and controlling processor based on wireless network low-power level signal and processing method

InactiveCN101442324BCancel noiseExcellent useful signalOpen water surveyTransmissionWireless routerGSM
The invention belongs to a monitoring processor used to extract a useful signal from high noise by being matched with a wireless router and so on in the remote monitoring and processing technique of a wireless network and a processing method thereof. The processor comprises a CPU, a communication module, a program read-write port module, a parallel communication module, an analog-digital conversion module, a constant current source module, a voltage transformation circuit, a signal filter and high voltage protection circuit, a signal amplifying module, a current signal adjusting circuit, a memory and a keyboard input circuit; and the method comprises: after the communication module receives a signal, firstly the threshold filtration of noise is performed, and the wavelet transformation processing of the signal is performed in the wavelet field through the CPU so as to reduce or completely eliminate the noise. Therefore, the processor and the method have the characteristics that the processor and the method can effectively extract the useful signal from a great amount of disorder noise signals, and automatically send the useful signal to a device such as a platform terminal and the like, and the point-to-point and one-to-many communications are realized; and the invention also provides a convenient and reliable method for mobile office work by utilizing the prior GSM network.
Owner:UNIV OF ELECTRONICS SCI & TECH OF CHINA

A self-defined function block and configuration encapsulation method based on component model

The invention provides an element model based customized function block and configuration packaging method. The method includes steps of a), defining an inheritable function block element model and designing a standard instantiation interface and a uniform data structure; b) instantiating algorithm type function blocks which are universal in industrial control field; c) defining a configuration file structure; d) based on a control strategy of the inheritable function block element model, packaging into a customized function block; e) storing the customized block information into an originalconfiguration file. According to the invention, from the perspective of function block modeling, thought of an object-oriented method is absorbed, typical features and key data information of the algorithm function block are extracted and the inheritable function block element model is established. On this basis, numerous basic algorithm function blocks of an arithmetic type, a logic type, a control type, a time type and the like are instantiated and algorithm configuration and debugging demands in industrial process control can be met.
Owner:NR ELECTRIC CO LTD +1

Specific primer pair for identifying processed auxiliary material turtle blood, kit and application

ActiveCN114672571AStrong subjectivityIdentification method scienceMicrobiological testing/measurementDNA/RNA fragmentationForward primerNucleotide
The invention relates to a specific primer pair and a kit for identifying processed auxiliary material turtle blood and application, the specific primer pair is composed of a forward primer and a reverse primer, and the nucleotide sequence of the forward primer is CTAGCAACCTAGCCCATGTG; and the nucleotide sequence of the reverse primer is GGATCTCCTCCTCCAGAAGG. The invention also provides application of the specific primer pair in turtle blood identification. The specific primer pair is good in specificity, only a polymerase chain reaction (PCR) amplification reaction needs to be carried out in a reaction system, the processing auxiliary material turtle blood and other animal blood can be rapidly and accurately identified only within 1 h, identification of the turtle blood and other animals can be achieved, and a perfect, objective, stable, accurate, scientific and reliable identification method is provided for the turtle blood.
Owner:NANJING UNIVERSITY OF TRADITIONAL CHINESE MEDICINE

Grounding line selection alarm correctness verification method based on SCADA data

PendingCN113884942AReduce false alarmsSmall error probabilityShort-circuit testingTransformerSCADA
The invention discloses a grounding line selection alarm correctness verification method based on SCADA data. The method comprises the following steps: the SCADA acquires various data in real time; the SCADA retrieves whether a bus grounding signal exists or not, and if so, whether the bus grounding signal comes from a first bus grounding signal sent by a transformer substation small current grounding line selection device or a second bus grounding signal calculated by the SCADA itself is judged; if the bus grounding signal is the first bus grounding signal, the SCADA retrieves a self grounding judgment condition within a first preset time when the first bus grounding signal is received, and whether the first bus grounding signal exists or not is compared; and if the bus grounding signal is a second bus grounding signal, the SCADA retrieves the received data within a second predetermined time when the second bus grounding signal is received, and compares whether the second bus grounding signal exists or not. According to the invention, the correctness of the grounding line selection signal of the low-current grounding line selection device at the current power plant station end can be verified, so that the accuracy of the grounding line selection alarm of the device is improved, and the device can be improved conveniently.
Owner:GUIZHOU POWER GRID CO LTD