Preparation method of cholera toxin B sub unit

A technology of cholera toxin and subunit, which is applied in the field of producing CTB to prepare drugs, and can solve the problems of cumbersome multi-step operation, low expression and high production cost in the post-processing process

Inactive Publication Date: 2004-07-14
ZHEJIANG UNIV
View PDF0 Cites 1 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0003] The CTB protein can be expressed in the E. coli system, and the expression level is high, but it does not contain glycosylation and forms inclusion bodies, which involves protein denaturation and renaturation, and brings tedious multi-step operations to the post-processing process; breastfeeding Animal cells can produce CTB protein, but culture medium and bovine serum are required, the production cost is high, and low expression is also a problem

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Preparation method of cholera toxin B sub unit
  • Preparation method of cholera toxin B sub unit
  • Preparation method of cholera toxin B sub unit

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0023] Example 1. Construction of CTB gene expression plasmid in Escherichia coli

[0024] Design primers based on the published CTB gene sequence ((Nature, 1983, 306:551-557), introduce the BamHI restriction site at the 5'end of the primer, and introduce the targeting sequence and EcoRI site at the 3'end. Upstream primer It is: 5'GGGGATCCATGATTAAATTAAAATTTGGT3', the downstream primer is: 5'GGGGAATTCTTATAGCTCATCTTTCTCAGAATTTGCCATACTAATTGCGGCAA3', take 1ml of cholera bacteria (Vibrio cholerae), centrifuge at 12000rpm for 5 minutes, take the precipitate, add 5μl 20g / L proteinase K and 10% GIBSOBDS company) ℃, 1 hour, add 500μl phenol, 12000rpm centrifugation for 10 minutes, take the supernatant, add 500μl chloroform (Zhejiang Dier Pharmaceutical Co., Ltd.), centrifuge at 12000rpm for 10 minutes, take the supernatant, add 2 times the volume of ethanol, and mix well Centrifuge at 12000rpm for 10 minutes, discard the supernatant, and add 50μl of water to dissolve. PCR amplification of ...

Embodiment 2

[0025] Example 2. Construction of insect baculovirus transfer plasmid of CTB gene

[0026] The pUC-CTB plasmid was digested with BamHI and EcoRI, and the digested fragments were connected to pBacPAK8 (CLONTECH), which was also digested with BamHI and EcoRI, to construct a baculovirus transfer plasmid pBac-CTB ( figure 1 ), the gene was identified as correct by restriction analysis.

Embodiment 3

[0027] Example 3 Obtaining the recombinant baculovirus of CTB gene

[0028] Take 5ul insect baculovirus transfer plasmid pBac-CTB containing CTB gene and 6ul wild Bombyx mori nuclear polyhedrosis virus DNA for co-transfection. Take 6ul Lipofectin (GIBCOBRL company) and add 100ul serum-free TC-100 medium and mix well. Wash the BmN cells pre-cultured in 35mm Dish with serum-free TC-100 (GIBCOBRL company) medium twice, and add the transfer plasmid and Lipofectin mixture dropwise, culture at 27°C for 4-5 days, collect the supernatant and proceed to the first A round of plaque screening. Take 5ul of supernatant to infect BmN cells in 35mmDish, discard the supernatant after 1 hour and add an equal amount of mixed TC-100 medium and low melting agarose. After 4-5 days, the plaques were picked, Bm N cells were infected for 3-4 days, the supernatant was preserved, the cells were lysed with NaOH for Southern hybridization, and the supernatant of positive clones was taken for the 10th round o...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
weightaaaaaaaaaa
Login to View More

Abstract

A process for preparing cholera toxin B subunit features that by the expression system of Bombyx mori nuclear polyhedrosis virus, the virus with CTB gene is recombined to obtain the recombinant virus (CGMCC No.0594) which has been preserved by Ordinory Microbe Preservation Center of China Microbial Strain Preservation and Management Committee. An oral medicine for treating cholera is prepared through inoculating the virus to the larva or pupa of Bombyx mori, expressing, separating, purifying, and freeze drying. Its advantages are high curative effect, and low cost.

Description

Technical field: [0001] The present invention relates to a method for preparing cholera toxin B subunit (CTB) protein from silkworm larvae and pupae through a silkworm baculovirus expression system. The present invention also relates to a method for preparing drugs by using silkworm larvae and pupae to produce CTB. Background technique: [0002] Cholera, caused by Vibrio cholerae, is a severe intestinal infectious disease, and its pathogenicity is mainly due to the cholera toxin produced by it. There are more than 2 million cases in the world, causing nearly 200,000 deaths, and serious harm to human health. The development of a cheap and effective cholera vaccine is an effective measure to prevent and treat cholera. Over the years, the physical and chemical properties and biological activity of cholera toxins The research on the structure and mechanism of toxin molecules has made important progress. Cholera toxin is composed of one A subunit and five B subunits, which are combine...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityPatents(China)
IPC IPC(8): A61K38/17A61P31/04C07K14/005C12N15/31C12N15/866
CPCY02A50/30
Inventor金勇丰张耀洲吴祥甫
OwnerZHEJIANG UNIV