Preparation method of cholera toxin B sub unit

A technology of cholera toxin and subunit, which is applied in the field of producing CTB to prepare drugs, and can solve the problems of low expression, high production cost, cumbersome and multi-step post-treatment process, etc.

Inactive Publication Date: 2003-07-02
ZHEJIANG UNIV
View PDF0 Cites 5 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0003] The CTB protein can be expressed in the E. coli system, and the expression level is high, but it does not contain glycosylation and forms inclusion bodies, which involves protein denaturation and renaturation, and brings tedious multi-step operations to the post-processing process; breastfeeding Animal cells can produce CTB protein, but culture medium and bovine serum are required, the production cost is high, and low expression is also a problem

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Preparation method of cholera toxin B sub unit
  • Preparation method of cholera toxin B sub unit
  • Preparation method of cholera toxin B sub unit

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0024] Embodiment 1, the construction of CTB gene Escherichia coli expression plasmid

[0025] Primers were designed according to the published CTB gene sequence ((Nature, 1983, 306:551-557), the BamHI restriction site was introduced at the 5' end primer, and the targeting sequence and EcoR I site were introduced at the 3' end. The upstream primer For: 5'GGGGATCCATGATTAAATTAAAATTTGGT3', the downstream primer is: 5'GGGGAATTCTTATAGCTCATCTTTTCTCAGAATTTGCCATACTAATTGCGGCAA3', take Vibrio cholerae (Vibrio cholerae) 1ml, centrifuge at 12000rpm for 5 minutes, take the precipitate, add 5μl 20g / L proteinase K (GIBCOBRL company) and 10% SDS70μl, ℃, 1 hour, add 500 μl phenol, centrifuge at 12,000 rpm for 10 minutes, take the supernatant, add 500 μl of chloroform (Zhejiang Dier Pharmaceutical Co., Ltd.), centrifuge at 12,000 rpm for 10 minutes, take the supernatant, add 2 times the volume of ethanol, and mix well , centrifuged at 12000rpm for 10 minutes, discarded the supernatant, and adde...

Embodiment 2

[0026] The construction of the insect baculovirus transfer plasmid of embodiment 2, CTB gene

[0027] From the pUC-CTB plasmid digested with BamHI and EcoRI, the digested fragment was connected to pBacPAK8 (CLONTECH company) which was also digested with BamHI and EcoRI, and the bacmid transfer plasmid pBac-CTB containing the CTB gene was constructed ( figure 1 ), the gene was identified to be correct by restriction analysis.

Embodiment 3

[0028] Embodiment 3, the acquisition of the recombinant baculovirus of CTB gene

[0029] Take 5ul insect baculovirus transfer plasmid pBac-CTB containing CTB gene and 6ul wild silkworm nuclear polyhedrosis virus DNA for co-transfection. Take 6ul Lipofectin (GIBCOBRL company) and add 100ul serum-free TC-100 medium and mix well. The BmN cells previously cultured in a 35mm Dish were washed twice with serum-free TC-100 (GIBCOBRL company) medium, and the transfer plasmid and Lipofectin mixture was added dropwise, cultured at 27°C for 4-5 days, and the supernatant was collected for the second stage. One round of plaque screening. Take 5ul of the supernatant to infect the BmN cells in a 35mmDish, discard the supernatant after 1 hour and add an equal amount of mixed TC-100 medium and low melting point agarose. Pick plaques after 4-5 days, infect BmN cells for 3-4 days, save the supernatant, lyse the cells with NaOH for Southern hybridization, and take the supernatant of positive clo...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

A process for preparing cholera toxin B subunit features that by the expression system of Bombyx mori nuclear polyhedrosis virus, the virus with CTB gene is recombined to obtain the recombinant virus (CGMCC No.0594) which has been preserved by Ordinory Microbe Preservation Center of China Microbial Strain Preservation and Management Committee. An oral medicine for treating cholera is prepared through inoculating the virus to the larva or pupa of Bombyx mori, expressing, separating, purifying, and freeze drying. Its advantages are high curative effect, and low cost.

Description

Technical field: [0001] The invention relates to a method for preparing cholera toxin B subunit (CTB) protein by using silkworm larvae and pupae through the silkworm baculovirus expression system, and also relates to a method for preparing medicine by using silkworm larvae and pupae to produce CTB. Background technique: [0002] Cholera, caused by Vibrio cholerae, is a severe intestinal infectious disease, and its pathogenicity is mainly due to the cholera toxin produced by it. There are more than 2 million cases in the world, resulting in nearly 200,000 deaths, which seriously endanger human health. The development of cheap and effective cholera vaccine is an effective measure to prevent and treat cholera. For many years, the physical and chemical properties and biological activities of cholera toxin , The research on the structure and mechanism of action of toxin molecules has made important progress. Cholera toxin is composed of one A subunit and five B subunits, the two...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): A61K38/17A61P31/04C07K14/005C12N15/31C12N15/866
CPCY02A50/30
Inventor金勇丰张耀洲吴祥甫
OwnerZHEJIANG UNIV