Gene reform immune globulin with low immunogenicity and its application
An immunoglobulin and immunogenic technology, applied in the direction of anti-plant immunoglobulin, allergic diseases, antibodies, etc., can solve problems such as lack of elasticity, and achieve the effect of simple method, elimination of immunogenicity, and high flexibility
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0073] Example 1, human framework sub-zone for RFB4 antibody light chain (VL) framework replacement selection
[0074] The sequence below is the VL amino acid sequence of murine RFB4, and the amino acids in the frame are the sequence of the determining complementary region.
[0075] D I Q M T Q T T S S L S A S L G D R V T I S C
[0076] W Y Q Q K P D G T V K L L I Y
[0077] G V P S R F S G S G S G T D Y S L T I S N L E Q E D F A T Y
[0078] F C F G G G T K L E I K
[0079] According to Kabat's method, it is subdivided into FR1, CDR1, FR2, CDR2, FR3, CDR3, FR4. The selection of each FR sub-region will be based on the above principles, according to the Kabat database (Kabat et al., op.cit) to compare the FR sub-region sequence of mouse VL with the corresponding human FR sub-region , as shown in the sequence below, is the comparison of the FR subregion sequence in the VL segment of the mouse RFB4 light chain with the corresponding but different human FR subregion se...
Embodiment 2
[0098] Example 2, human framework subregions for the selection of RFB4 antibody heavy chain (VH) framework replacement:
[0099] The following sequence is the VH amino acid sequence of murine RFB4. The amino acids in the box are the sequences determining the complementarity region.
[0100] E V Q L V E S G G G L V K P G G S L K L S C A A S G F A F S
[0101] W V R Q T P E K R L E W V A
[0102] R F T I S R D N A K N T L Y L Q M S S L
[0103] K S E D T A M Y Y C A R W G
[0104] Q G T L V T V S A
[0105] According to Kabat's method, it is subdivided into FR1, CDR1, FR2, CDR2, FR3, CDR3, FR4. As shown in the sequence below, it is a comparison of the FR subregion sequence in the VH segment of the murine RFB4 heavy chain with the corresponding but different human FR subregion sequence (italics), and the complementary sequence is determined in the box. The selection of each FR sub-region will be based on the above principles, and according to the Kabat database (Kab...
Embodiment 3
[0136] Embodiment 3, the synthesis of frame replacement VL gene:
[0137] The frame substitution VL amino acid sequence was converted into the DNA sequence of sequence 1 according to the codons commonly used in mammalian cells. The entire DNA sequence is divided into N-terminal half and C-terminal half (N-terminal half and C-terminal half). The N-terminal and C-terminal two parts can be connected into a complete VL gene sequence through the SpeI restriction cut point.
[0138] The synthesis of the N-terminal part is as follows:
[0139] The chemically synthesized N-terminal sense-strand oligonucleotide (N-terminal sense-strand oligonucleotide) contains 108 bases, encoding the 11th to 46th VL amino acids
[0140] [5'CTGTCTGCCTCTGTGGGAGACAGAGTCACCATTAGTTGCAGGGCAAGTCAGGACATTAGCAATTATTAAACTGGTATCAGCAGAAACCAGGTAAGGCTCCGAAACTC3'] will serve as a template for the polymerase chain reaction (Polymerase Chain Reaction: PCR).
[0141] 5' Primer for PCR
[0142] [5'GATATCCAGATGACCCAGT...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 