Unlock instant, AI-driven research and patent intelligence for your innovation.

Gene reform immune globulin with low immunogenicity and its application

An immunoglobulin and immunogenic technology, applied in the direction of anti-plant immunoglobulin, allergic diseases, antibodies, etc., can solve problems such as lack of elasticity, and achieve the effect of simple method, elimination of immunogenicity, and high flexibility

Inactive Publication Date: 2006-09-06
梁瑞安
View PDF3 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

This method lacks flexibility. Importantly, the amino acid residues of the mouse donor framework inserted into the human acceptor framework region in order to maintain the original specificity and affinity are likely to introduce new immunogenic epitopes (ImmunogenicEpitope)

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Gene reform immune globulin with low immunogenicity and its application
  • Gene reform immune globulin with low immunogenicity and its application
  • Gene reform immune globulin with low immunogenicity and its application

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0073] Example 1, human framework sub-zone for RFB4 antibody light chain (VL) framework replacement selection

[0074] The sequence below is the VL amino acid sequence of murine RFB4, and the amino acids in the frame are the sequence of the determining complementary region.

[0075] D I Q M T Q T T S S L S A S L G D R V T I S C

[0076] W Y Q Q K P D G T V K L L I Y

[0077] G V P S R F S G S G S G T D Y S L T I S N L E Q E D F A T Y

[0078] F C F G G G T K L E I K

[0079] According to Kabat's method, it is subdivided into FR1, CDR1, FR2, CDR2, FR3, CDR3, FR4. The selection of each FR sub-region will be based on the above principles, according to the Kabat database (Kabat et al., op.cit) to compare the FR sub-region sequence of mouse VL with the corresponding human FR sub-region , as shown in the sequence below, is the comparison of the FR subregion sequence in the VL segment of the mouse RFB4 light chain with the corresponding but different human FR subregion se...

Embodiment 2

[0098] Example 2, human framework subregions for the selection of RFB4 antibody heavy chain (VH) framework replacement:

[0099] The following sequence is the VH amino acid sequence of murine RFB4. The amino acids in the box are the sequences determining the complementarity region.

[0100] E V Q L V E S G G G L V K P G G S L K L S C A A S G F A F S

[0101] W V R Q T P E K R L E W V A

[0102] R F T I S R D N A K N T L Y L Q M S S L

[0103] K S E D T A M Y Y C A R W G

[0104] Q G T L V T V S A

[0105] According to Kabat's method, it is subdivided into FR1, CDR1, FR2, CDR2, FR3, CDR3, FR4. As shown in the sequence below, it is a comparison of the FR subregion sequence in the VH segment of the murine RFB4 heavy chain with the corresponding but different human FR subregion sequence (italics), and the complementary sequence is determined in the box. The selection of each FR sub-region will be based on the above principles, and according to the Kabat database (Kab...

Embodiment 3

[0136] Embodiment 3, the synthesis of frame replacement VL gene:

[0137] The frame substitution VL amino acid sequence was converted into the DNA sequence of sequence 1 according to the codons commonly used in mammalian cells. The entire DNA sequence is divided into N-terminal half and C-terminal half (N-terminal half and C-terminal half). The N-terminal and C-terminal two parts can be connected into a complete VL gene sequence through the SpeI restriction cut point.

[0138] The synthesis of the N-terminal part is as follows:

[0139] The chemically synthesized N-terminal sense-strand oligonucleotide (N-terminal sense-strand oligonucleotide) contains 108 bases, encoding the 11th to 46th VL amino acids

[0140] [5'CTGTCTGCCTCTGTGGGAGACAGAGTCACCATTAGTTGCAGGGCAAGTCAGGACATTAGCAATTATTAAACTGGTATCAGCAGAAACCAGGTAAGGCTCCGAAACTC3'] will serve as a template for the polymerase chain reaction (Polymerase Chain Reaction: PCR).

[0141] 5' Primer for PCR

[0142] [5'GATATCCAGATGACCCAGT...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

A gene modified immunoglobuline with low immunogenicity and its application are disclosed. The said immunoglobuline features that in its light-chain or heavy-chain variable region, at least one mother FR subzone sequence is substituted or displaced by relative FR subzone heterogous to mother antibody, its should contain at least two different FR subzone sequences, and its specificity and affinity are increased by less than 3 times.

Description

technical field [0001] The invention relates to an immunoglobulin and its application. Background technique [0002] Since Kohler and Milstein (Continuous Cultures of fused cells secreting antibody of predefined specificity. Nature. 1975.256: 495-497) founded the B lymphocyte hybridoma cell fusion technology in 1975, the application of monoclonal antibodies in clinical diagnosis, treatment and prevention The value and development prospects have been generally affirmed. However, it is only in recent years that the clinical application of monoclonal antibodies has become mainstream. The main problem is that most monoclonal antibodies are derived from mouse B-cell hybridomas. These mouse-derived antibodies not only trigger the "anti-mouse antibody" immune response in the human body (Human-Anti-Mouse-Antibody (HAMA) response), but also lack the ability to guide the body's own immune function such as complement-mediated cellular immunity (Complement-Mediated Cell Cytotoxicity:...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C07K16/16A61K39/395A61P37/00
Inventor 梁瑞安
Owner 梁瑞安