Unlock instant, AI-driven research and patent intelligence for your innovation.

Method, reagent box and use for identifying variety of natural plant

A kit and genuine technology, applied in the field of identification of genuine Tibetan Swertia chinensis, Molecular kits for identification of genuine Tibetan Swertia chinensis, can solve problems such as inability to complete the identification

Inactive Publication Date: 2006-09-13
CHINA ACAD OF SCI NORTHWEST HIGHLAND BIOLOGY INST
View PDF0 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

The identification of authentic and counterfeit "Zang Yinchen" medicinal materials cannot be completed by using the active ingredient test in chemistry; in addition, anatomy and morphology cannot identify a certain type of medicinal materials that have been processed (such as grinding, etc.), because these types The micromorphological characteristics are very similar, and it can only be identified whether the medicinal materials examined belong to the general category of "Tibetan capillary".

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Examples

Experimental program
Comparison scheme
Effect test

Embodiment Construction

[0011] Molecular kit for identification of genuine Tibetan Swertia chinensis, the reaction solution of the kit is mainly composed of DNA fragment primers ID1: GGCTTGCCTCTCGACGCTC, ID2: GCAAGCGTCACGAAGACGCG, DMSO reagent, double distilled water, buffer, dNTP, Taq enzyme, among which the reaction solution The volume ratio of each component is: double distilled water: 25 μl, 10×tris-CL buffer: 5 μl, dNTP 8 mmol / L 5 μl, primer ID1 2 μmol / L 2.5 μl, primer ID2 2 μmol / L 2.5 μl, reagent DMSO 1.5 mmol / L 0.2μl, Taq enzyme Unit / μL 0.3μl.

[0012] The identification method comprises the following steps: ① Extract the total DNA from the medicinal material of Capillary chinensis; ② Take 10 μl of the extracted DNA and drop it into the reaction solution of the kit described in claim 1, so that the DNA can be amplified by PCR; , 94°-1 minute, 62°-40 seconds, 72°-50 seconds, cycle 2 times, then 94°-20 seconds, 55°-20 seconds, 72°-50 seconds, cycle 38 times, and then at 72 °Incubation for 4 min...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

A method for identifying variety of natural plant and use for verifying capillary artemisia medicine variety include: 1) extracting general DNA of medicine, 2) PCR amplifying for extracted DNA by primer, 3) purifying amplified PCR product, 4) sequencing purified PCR product by sequencer, obtaining base sequence, comparing the base sequence with DNA sequence of plant, and determining variety of the medicine.

Description

technical field [0001] The present invention relates to a molecular kit of natural plant varieties, in particular to a molecular kit for identifying authentic Tibetan Swertia chinensis, and also relates to a method for identifying genuine Tibetan Swertia swertia. Background technique [0002] According to the country's regulations on medicinal materials, only the plant species that have entered the Pharmacopoeia can be used in medicines after they have passed the inspection of efficacy, pharmacology and safety performance. Even if the type contains the same medicinal ingredients, if it is not included in the Pharmacopoeia, it cannot be used in medicines, because it may also contain other unknown and unsafe ingredients. There are many varieties of medicinal materials currently on the market, many of which have similar names and appearances but differ greatly in price, and after the medicinal materials are dried or processed, it is difficult to identify the characteristics of ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C12Q1/68
Inventor 刘建全王玉金李小鹃党雪艳
Owner CHINA ACAD OF SCI NORTHWEST HIGHLAND BIOLOGY INST