Method, reagent box and use for identifying variety of natural plant
A kit and genuine technology, applied in the field of identification of genuine Tibetan Swertia chinensis, Molecular kits for identification of genuine Tibetan Swertia chinensis, can solve problems such as inability to complete the identification
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Examples
Embodiment Construction
[0011] Molecular kit for identification of genuine Tibetan Swertia chinensis, the reaction solution of the kit is mainly composed of DNA fragment primers ID1: GGCTTGCCTCTCGACGCTC, ID2: GCAAGCGTCACGAAGACGCG, DMSO reagent, double distilled water, buffer, dNTP, Taq enzyme, among which the reaction solution The volume ratio of each component is: double distilled water: 25 μl, 10×tris-CL buffer: 5 μl, dNTP 8 mmol / L 5 μl, primer ID1 2 μmol / L 2.5 μl, primer ID2 2 μmol / L 2.5 μl, reagent DMSO 1.5 mmol / L 0.2μl, Taq enzyme Unit / μL 0.3μl.
[0012] The identification method comprises the following steps: ① Extract the total DNA from the medicinal material of Capillary chinensis; ② Take 10 μl of the extracted DNA and drop it into the reaction solution of the kit described in claim 1, so that the DNA can be amplified by PCR; , 94°-1 minute, 62°-40 seconds, 72°-50 seconds, cycle 2 times, then 94°-20 seconds, 55°-20 seconds, 72°-50 seconds, cycle 38 times, and then at 72 °Incubation for 4 min...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More