Fusion protein with cold proventing and curing function and its encoding gene and use

A technology of fusion protein and coding gene, which is applied in the field of fusion protein and its coding gene and vaccines with the protein as the active ingredient, which can solve the problem of unguaranteed immune effect, inability to guarantee the number of M2e epitope polypeptides, and affecting the production and promotion of influenza vaccines and other issues to achieve the effect of improved safety and mature production technology

Inactive Publication Date: 2006-10-18
TSINGHUA UNIV
View PDF0 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

(3) Influenza virus subunit vaccine, which is the influenza vaccine currently used by foreign children. It uses genetically recombined virus surface antigens to induce immune protection. Virus surface antigens also need to be replaced in time with the antigenic variation of influenza strains, otherwise The immune effect is not guaranteed, or even invalid
[0005] Most of the influenza vaccines currently designed based on the M2e epitope of influenza virus adopt the design idea of ​​coupling the M2e epitope polypeptide to the carrier protein (Vaccine 2003, 21: 2616-2626; Vaccine 2004, 22: 2993-3003

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Fusion protein with cold proventing and curing function and its encoding gene and use
  • Fusion protein with cold proventing and curing function and its encoding gene and use
  • Fusion protein with cold proventing and curing function and its encoding gene and use

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0032] Embodiment 1, GST-(M2e) 16 , GST-(M2e) 4 and GST-M2e preparation and identification

[0033] 1. GST-(M2e) 16 , GST-(M2e) 4 Construction of three fusion protein genes with GST-M2e

[0034] Oligonucleotide chains L1, L2, P1 and P2 were synthesized by Beijing Aoke Biotechnology Co., Ltd. using 8909 Expedite automatic nucleic acid synthesis instrument, and identified by gel purification. Their sequence is as follows: L1:5`GCGC GGATCC ATGTCCCTGCTGACTGAAGTTGAAACTCCGATCCGTAACGAATG 3' (bases underlined are BamH I recognition sequences);

[0035] L2: 5`GTTATCA AGATCT GTCGGAGGAGTCGTTGCAACGGCAACCCCATTCGTTACGG 3' (the underlined base is the Bgl II recognition sequence);

[0036] P1: 5`GTGCGC GGATCC 3' (the underlined base is the BamH I recognition sequence);

[0037] P2: 5` CTCGAG TTATCA AGATCT 3' (the underlined base at the 5' end is the Xho I recognition sequence, and the underlined base at the 3' end is the Bgl II recognition sequence)

[0038] Use P1 and P2 as ...

Embodiment 2

[0058] Embodiment 2, GST-(M2e) 16 Induced antibody level experiments

[0059] image 3 Graphically represent GST, GST-M2e, GST-(M2e) with legend 4 and GST-(M2e) 16 The epitope density of M2e in M2e, using M0, M1, M4 and M16 to represent GST, GST-M2e, GST-(M2e) respectively 4 and GST-(M2e) 16 .

[0060] Carry out the immunization experiment of mouse (BALB / c) and New Zealand white rabbit as animal model according to the following method:

[0061] A total of 32 female Balb / c mice of 16-20 grams were randomly divided into four groups, and immunogens (GST, GST-M2e, GST-(M2e) 4 or GST-(M2e) 16 ) to immunize 8 mice intraperitoneally. For the first time, each mouse was injected with complete Freund's adjuvant (PIERCE company product) 1:1 emulsified recombinant immunogen diluted in PBS 50 μg, and the immune volume was 200 μl for the first subcutaneous multi-point (4 points) injection immunization, and each point was injected subcutaneously. 50 μL. Afterwards, they were immuni...

Embodiment 3

[0064] Embodiment 3, GST-M2e, GST-(M2e) 4 and GST-(M2e) 16 The concentration of induced rabbit serum M2e-specific antibody and the experiment of recognizing the natural M2 protein of influenza virus

[0065] 1. Identification of GST-(M2e) using M2e epitope peptide-specific affinity chromatography column 16 , GST-(M2e) 4 , The principle and steps of the preparation of the experimental affinity chromatography column for the concentration of the M2e epitope polypeptide-specific antibody in the rabbit antiserum induced by GST-M2e: using the active group NHS-easy on the column product Sepharose4-FAST of Pharmacia Company NH with M2e epitope peptide amino acid 2 - The characteristics of group combination reacting and relatively stable coupling complete the preparation of the affinity chromatography column.

[0066] (1) Draw 1ml of NHS-activated_Sepharose4-FAST column material (Pharmacia company), and 2mg of M2e epitope polypeptide (synthesized by American Genemed Synthesis compa...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

PropertyMeasurementUnit
Diameteraaaaaaaaaa
Login to view more

Abstract

The invention discloses a fusion protein with the effect of preventing and treating influenza, its encoding gene and its application, and aims to provide the fusion protein with the effect of preventing and controlling the influenza, its encoding gene and a vaccine medicine with the protein as an active ingredient. The fusion protein with the effect of preventing and treating influenza provided by the present invention is SEQ ID No.: 1 in the sequence listing, and its coding sequence is SEQ ID No.: 2 in the sequence listing. The fusion protein with the effect of preventing and treating influenza can be used as a vaccine for preventing influenza virus.

Description

technical field [0001] The invention relates to a fusion protein capable of preventing and treating influenza, its encoding gene and its application, in particular to a fusion protein capable of preventing and controlling influenza, its encoding gene and a vaccine with the protein as an active ingredient. Background technique [0002] Influenza is a common and multiple infectious disease caused by viruses, which poses a great threat to human beings, especially the elderly, children and weak people. At the same time, influenza outbreaks also have a serious impact on the entire society and economic development. Existing influenza vaccine has following three kinds: (1) influenza virus inactivated vaccine, this vaccine is widely used in adult at present, is to utilize the pathogen after the influenza virus inactivation to make. However, the vaccine strain needs to be replaced in time with the antigenic variation of the influenza virus strain, otherwise the immune effect will not...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
IPC IPC(8): C07K19/00C12N15/62C12N1/21C12P19/34A61K39/145A61K38/16A61P31/16C12N15/63
Inventor 陈应华刘万里
Owner TSINGHUA UNIV
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap