Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Detection probe for ocean Prorocentrum

A technology for detecting probes and Prorocentrum, applied in the field of oligonucleotide probes, can solve the problems of large fluctuations in detection results, small number of captured probes, and difficult operation

Inactive Publication Date: 2005-07-06
SHANGHAI JIAO TONG UNIV +1
View PDF0 Cites 4 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Its main disadvantages are: first, because the length of the capture probe is only 10-30bp, the number of capture probes that can effectively distinguish close relatives of microalgae is very small; second, RNA degradation needs to be prevented during the entire detection process, but Various steps such as washing and antibody reaction can easily cause RNA degradation, so the operation is difficult and the test results fluctuate greatly

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Detection probe for ocean Prorocentrum
  • Detection probe for ocean Prorocentrum

Examples

Experimental program
Comparison scheme
Effect test

Embodiment

[0029] Example: Qualitative and quantitative detection of marine Prorocentrum by using S1 enzyme protection analysis for rRNA and sandwich hybridization technology

[0030] In this embodiment, the S1 enzyme protection analysis technique and the sandwich hybridization technique are combined to realize the qualitative and quantitative detection of marine red tide organism Prorocentrum micans (Prorocentrum micans), the steps are as follows:

[0031]1.1 The search for the specific region of marine Prorocentrum rRNA and the design and synthesis of the S1 enzyme protection analysis probe. The 430-520 region of the large subunit rRNA is different from other algae, and the sequence of this region is determined to be a characteristic sequence; according to the specific

[0032] Sequence design and synthesis of S1 enzyme protection analysis probe MIC_S1: 5'-ACCAGGCACATTCACCCACCCAGGGGTAGGCTACCATGTCCCTGGAGTTTTCCTCGAT (SEQ ID NO.1).

[0033] Design and synthesis of additional probes requi...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

A detection probe for Prorocentrum micans Ehrenberg belongs to the nucleic acid detection field. It is used for S1 enzyme protection analysis and sandwich hybridization detection of the Prorocentrum micans Ehrenberg, and comprises three correlative oligonucleotide probes. Wherein a S1 enzyme protection analysis probe only serves as a complement of the nucleotides in the Prorocentrum micans Ehrenberg ribosome big subunit 430~520 regions, and shows no homology with other Prorocentrum micans Ehrenberg ribosome RNAs. The S1 enzyme protection analysis probe has a length of 58bp, and can be combined specifically onto the rRNAs of the Prorocentrum micans Ehrenberg under certain conditions, and the sequence is: 5'-ACCAGGCACATTCACCCACCCAGGGGTAGGCTACCATGTCCCTGGAGTTTTCCTCGAT. The invented probes have excellent applicability to make it convenient to seek and realize the specific probe. The invention has higher stability than that of the sandwich hybridization technology.

Description

technical field [0001] The invention relates to a group of oligonucleotide probes used for algae detection in the field of nucleic acid detection, in particular to specific probes for qualitative and quantitative detection of marine Prorocentrum. Background technique [0002] Prorocentrum micans is a common dinoflagellate that is widely distributed in coastal areas, estuaries, oceanic waters, and China's offshore waters, East China Sea, Hong Kong, and Nansha Islands. It is one of the main red tide organisms. Harmful red tides have been formed in the waters of Zhoushan and Hong Kong many times, causing a large number of deaths of farmed fish, posing a huge threat to marine fisheries. Therefore, it is of great significance to detect the population dynamics of marine Prorocentrum in the marine environment in a timely, accurate and rapid manner, and to keep abreast of its quantity changes in the ocean. The traditional identification method of directly observing and counting wit...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12Q1/04C12Q1/68
Inventor 李荣秀于志刚蔡青松米铁柱甄毓
Owner SHANGHAI JIAO TONG UNIV
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products