Detection probe for ocean Prorocentrum
A technology for detecting probes and Prorocentrum, applied in the field of oligonucleotide probes, can solve the problems of large fluctuations in detection results, small number of captured probes, and difficult operation
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment
[0029] Example: Qualitative and quantitative detection of marine Prorocentrum by using S1 enzyme protection analysis for rRNA and sandwich hybridization technology
[0030] In this embodiment, the S1 enzyme protection analysis technique and the sandwich hybridization technique are combined to realize the qualitative and quantitative detection of marine red tide organism Prorocentrum micans (Prorocentrum micans), the steps are as follows:
[0031]1.1 The search for the specific region of marine Prorocentrum rRNA and the design and synthesis of the S1 enzyme protection analysis probe. The 430-520 region of the large subunit rRNA is different from other algae, and the sequence of this region is determined to be a characteristic sequence; according to the specific
[0032] Sequence design and synthesis of S1 enzyme protection analysis probe MIC_S1: 5'-ACCAGGCACATTCACCCACCCAGGGGTAGGCTACCATGTCCCTGGAGTTTTCCTCGAT (SEQ ID NO.1).
[0033] Design and synthesis of additional probes requi...
PUM
Abstract
Description
Claims
Application Information
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com