Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Immunodeficiency recombinant poxvirus

a technology virus, which is applied in the field of immunodeficiency recombinant poxvirus, can solve the problems of compromising the ability of the virus to grow on serum starved cells, lack of significant pathogenic properties, and inactivation or complete deletion of the thymidine kinase gene, etc., to achieve the effect of improving safety

Inactive Publication Date: 2003-12-04
PAOLETTI ENZO +4
View PDF0 Cites 2 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Benefits of technology

[0040] It is therefore an object of this invention to provide modified recombinant viruses, which viruses have enhanced safety, and to provide a method of making such recombinant viruses.
[0041] It is an additional object of this invention to provide a recombinant poxvirus antigenic, vaccine or immunological composition having an increased level of safety compared to known recombinant poxvirus vaccines.

Problems solved by technology

However, recombination can also take place between sections of DNA in different genomes that are not perfectly homologous.
The recombinant virus must present the immunogen(s) in a manner that elicits a protective immune response in the vaccinated animal but lacks any significant pathogenic properties.
Inactivation or complete deletion of the thymidine kinase gene does not prevent growth of vaccinia virus in a wide variety of cells in tissue culture.
Loss of virally encoded ribonucleotide reductase activity in herpes simplex virus (HSV) by deletion of the gene encoding the large subunit was shown to have no effect on viral growth and DNA synthesis in dividing cells in vitro, but severely compromised the ability of the virus to grow on serum starved cells (Goldstein et al., 1988).
Twelve years later, despite a massive, worldwide effort, an effective HIV1 vaccine is still not available.
Unfortunately, different strains of HIV1 exhibit extensive genetic and antigenic variability, especially in the envelope glycoprotein.
Despite these responses, however, the vast majority of HIV1-infected people eventually succumb to HIV1-associated diseases.
Conversely, sera from individuals vaccinated with HIV1 gp120 can neutralize lab-adapted strains of HIV1 (although 10.times. higher titers relative to sera from seropositive individuals are required), but can not neutralize (at assayable levels) primary isolates (Hanson, 1994).
Unfortunately, this epitope does not appear to be very immunogenic in its normal configuration.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Immunodeficiency recombinant poxvirus
  • Immunodeficiency recombinant poxvirus
  • Immunodeficiency recombinant poxvirus

Examples

Experimental program
Comparison scheme
Effect test

example 1

Construction of Plasmid pSD460 for Deletion of Thymidine Kinase Gene (J2R)

[0130] Referring now to FIG. 1, plasmid pSD406 contains vaccinia HindIII J (pos. 83359-88377) cloned into pUC8. pSD406 was cut with HindIII and PvuII, and the 1.7 kb fragment from the left side of HindIII J cloned into pUC8 cut with HindIII / SmaI, forming pSD447. pSD447 contains the entire gene for J2R (pos. 83855-84385). The initiation codon is contained within an NlaIII site and the termination codon is contained within an SspI site. Direction of transcription is indicated by an arrow in FIG. 1.

[0131] To obtain a left flanking arm, a 0.8 kb HindIII / EcoRI fragment was isolated from pSD447, then digested with NlaIII and a 0.5 kb HindIII / NlaIII fragment isolated. Annealed synthetic oligonucleotides MPSYN43 / MPSYN44 (SEQ ID NO:1 / SEQ ID NO:2)

1 SmaI MPSYN43 5' TAATTAACTAGCTACCCGGG 3' MPSYN44 3' GTACATTAATTGATCGATGGGCCCTTAA 5' NlaIII EcoRI

[0132] were ligated with the 0.5 kb HindIII / NlaIII fragment into pUC18 vector p...

example 2

Construction of Plasmid pSD486 for Deletion of Hemorrhagic Region (B13R+B14R)

[0136] Referring now to FIG. 2, plasmid pSD419 contains vaccinia SalI G (pos. 160,744-173,351) cloned into pUC8. pSD422 contains the contiguous vaccinia SalI fragment to the right, SalI J (pos. 173,351-182,746) cloned into pUC8. To construct a plasmid deleted for the hemorrhagic region, u, B13R-B14R (pos. 172,549-173,552), pSD419 was used as the source for the left flanking arm and pSD422 was used as the source of the right flanking arm. The direction of transcription for the u region is indicated by an arrow in FIG. 2.

[0137] To remove unwanted sequences from pSD419, sequences to the left of the NcoI site (pos. 172,253) were removed by digestion of pSD419 with NcoI / SmaI followed by blunt ending with Klenow fragment of E. coli polymerase and ligation generating plasmid pSD476. A vaccinia right flanking arm was obtained by digestion of pSD422 with HpaI at the termination codon of B14R and by digestion with Nr...

example 3

Construction of Plasmid pMP494.DELTA. for Deletion of ATI Region (A26L)

[0142] Referring now to FIG. 3, pSD414 contains SalI B cloned into pUC8. To remove unwanted DNA sequences to the left of the A26L region, pSD414 was cut with XbaI within vaccinia sequences (pos. 137,079) and with HindIII at the pUC / vaccinia junction, then blunt ended with Klenow fragment of E. coli polymerase and ligated, resulting in plasmid pSD483. To remove unwanted vaccinia DNA sequences to the right of the A26L region, pSD483 was cut with EcoRI (pos. 140,665 and at the pUC / vaccinia junction) and ligated, forming plasmid pSD484. To remove the A26L coding region, pSD484 was cut with NdeI (partial) slightly upstream from the A26L ORF (pos. 139,004) and with HpaI (pos. 137,889) slightly downstream from the A26L ORF. The 5.2 kb vector fragment was isolated and ligated with annealed synthetic oligonucleotides ATI3 / ATI4 (SEQ ID NO:12 / SEQ ID NO:13)

6 NdeI ATI3 5' TATGAGTAACTTAACTCTTTTGTTAATTAAAAGTATATTC-AAAAAATAAGT A...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
apparent molecular weightsaaaaaaaaaa
apparent molecular weightsaaaaaaaaaa
temperatureaaaaaaaaaa
Login to View More

Abstract

Attenuated recombinant viruses containing DNA encoding an immunodeficiency virus and / or CTL antigen, as well as methods and compositions employing the viruses, expression products therefrom, and antibodies generated from the viruses or expression products, are disclosed and claimed. The recombinant viruses can be NYVAC or ALVAC recombinant viruses. The DNA can code for at least one of: HIV1gag(+pro)(IIIB), gp120(MN)(+transmembrane), nef(BRU)CTL, pol(IIIB)CTL, ELDKWA or LDKW epitopes, preferably HIV1gag(+pro)(IIIB), gp120(MN) (+transmembrane), two (2) nef(BRU)CTL and three (3) pol(IIIB)CTL epitopes; or two ELDKWA in gp120 V3 or another region or in gp160. The two (2) nef(BRU)CTL and three (3) pol(IIIB)CTL epitopes are preferably CTL1, CTL2, pol1, pol2 and pol3. The recombinant viruses and gene products therefrom and antibodies generated by the viruses and gene products have several preventive, therapeutic and diagnostic uses. DNA from the recombinant viruses are useful as probes or, for generating PCR primers or for immunization. Also disclosed and claimed are HIV immunogens and modified gp160 and gp120.

Description

[0001] This application is a continuation-in-part of application Ser. No. 08 / 223,842, filed Apr. 6, 1994 which in turn is a continuation-in-part of application Ser. No. 07 / 897,382, filed Jun. 11, 1992, which in turn is a continuation-in-part of application Ser. No. 07 / 715,921, filed Jun. 14, 1991. This application is also a continuation-in-part of application Ser. No. 08 / 105,403, filed Aug. 13, 1993, which in turn is a continuation of application Ser. No. 07 / 847,951, filed Mar. 6, 1992, which in turn is a continuation-in-part of application Ser. No. 07 / 713,967, filed Jun. 11, 1991, which in turn is a continuation in part of application Ser. No. 07 / 666,056, filed Mar. 7, 1991. Mention is also made of co-pending application Ser. No. 08 / 184,009, filed Jan. 19, 1994 as a continuation-in-part of application Ser. No. 08 / 007,115, filed Jan. 20, 1993. Each of the aforementioned and above-referenced applications is hereby incorporated herein by reference.[0002] The present invention relates ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(United States)
IPC IPC(8): A61K39/00C12N15/09A61K39/12A61K39/21A61K39/275A61P31/12C07K14/015C07K14/02C07K14/03C07K14/035C07K14/045C07K14/05C07K14/06C07K14/065C07K14/07C07K14/11C07K14/12C07K14/125C07K14/145C07K14/15C07K14/155C07K14/16C07K14/175C07K14/18C07K14/33C12N7/00C12N15/00C12N15/49C12N15/863C12R1/92
CPCA61K39/00C12N2770/24143C07K14/005C07K14/33C07K2319/00C12N15/86C12N2710/16222C12N2710/16622C12N2710/16722C12N2710/24022C12N2710/24043C12N2710/24122C12N2710/24143C12N2730/10122C12N2740/13022C12N2740/15022C12N2740/16122C12N2740/16222C12N2740/16322C12N2750/14322C12N2760/12022C12N2760/16122C12N2760/18122C12N2760/18722C12N2760/20022C12N2760/20122C12N2770/24022C12N2770/24122A61K2039/5254A61P31/12A61P31/18A61P37/02A61P37/04
Inventor PAOLETTI, ENZOTARTAGLIA, JAMESCOX, WILLIAM I.GALLO, ROBERTFRANCHINI, GENOVEFFA
Owner PAOLETTI ENZO
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com