Antibodies, polypeptides and uses thereof

a polypeptide and antibody technology, applied in the field of antibodies and polypeptides, can solve the problems of abnormal increase in the density of the vessel, severe limitation of the growth of tumors that fail to attract a blood supply, and deregulation of the growth of the blood vessel

Inactive Publication Date: 2008-01-24
CANCER RES TECH LTD
View PDF15 Cites 27 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Tumours that fail to attract a blood supply are severely limited in their growth.
However, a deregulation of blood vessel growth and an abnor

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Antibodies, polypeptides and uses thereof
  • Antibodies, polypeptides and uses thereof
  • Antibodies, polypeptides and uses thereof

Examples

Experimental program
Comparison scheme
Effect test

example 1

Preparation of Antibodies

[0261] The cDNA constructs that were used were as described in Table 2:

TABLE 2Full length MR cDNAMR ectodomain-FcMR IgA + B-FcMR IgA-Fc

[0262]“Fc” refers to the Fc region of the pIG vector. It is human IgG constant domains hinge, CH1, CH2, within the ends of the vector (multiple cloning site and splice acceptor region included). The nucleotide sequence of the vector is:

(SEQ ID NO: 31)AAGCTTGATATCGAATTCTGCAGCCCGGGGGATCCGGAGGGAGGGTGTCTGCTGGAAGCAGGCTCAGCGCTCCTGCCTGGACGCATCCCGGCTATGCAGCCCCAGTCCAGGGCAGCAAGGCAGGCCCCGTCTGCCTCTTCACCCGGAGGCCTCTGCCCGCCCCACTCATGCTCAGGGAGAGGGTCTTCTGGCTTTTTCCCCAGGCTCTGGGCAGGCACAGGCTAGGTGCCCCTAACCCAGGCCCTGCACACAAAGGGGCAGGTGCTGGGCTCAGACCTGCCAAGAGCCATATCCGGGAGGACCCTGCCCCTGACCTAAGCCCACCCCAAAGGCCAAACTCTCCACTCCCTCAGCTCGGACACCTTCTCTCCTCCCAGATTCCAGTAACTCCCAATCTTCTCTCTGCAGAGCCCAAATCTTGTGACAAAACTCACACATGCCCACCGTGCCCAGGTAAGCCAGCCCAGGCCTCGCCCTCCAGCTCAAGGCGGGACAGGTGCCCTAGAGTAGCCTGCATCCAGGGACAGGCCCCAGCCGGGTGCTGACACGTCCACCTCCATCTCTTCCTCAGCACCTCAACT...

example 2

The Antibody MR7 and the MR Ectodomain (Extracellular Fragment of MR Residues 1-467) Inhibit Formation of Vessel Sprouts in the Aortic Ring Assay

Summary

[0294] The role of MR in angiogenesis was investigated using the rat aortic ring assay. Segments of rat aorta were embedded in Matrigel and treated with either antibody MR7 or purified MR ectodomain protein. The sprouting vessels were allowed to develop over five day before scoring by three independent observers. The averaged scores over 20-25 separate experiments are shown in FIGS. 6A and 6B. Inter-scorer reliability was assessed using the method of Landis and Koch. The weighted kappa values calculated were 0.96 for MR7 and 0.93 for MR ectodomain. These kappa values show that there was a high degree of consistency between independent scorers.

Methods

[0295] Aortas were harvested from 200 g-300 g rats (6-8 weeks old) and immediately placed in MCDB 131 media. Connective tissue was removed and aortas cut into 1 mm-1.5 mm rings. 48-...

example 3

The MR Ectodomain (Extracellular Fragment of MR Residues 1-467) Inhibits Formation of Vessel Sprouts In Vivo

[0304] The ability of the MR ectodomain to inhibit angiogenesis in vivo was tested using a sponge angiogenesis assay (Hori Y. et al (1996) “Differential effects of angiostatic steroids and dexamethasone on angiogenesis and cytokine levels in rat sponge implants”Br. J. Pharmacol. 118(7): 1584-1591) performed on female C57 black mice. All mice received a subcutaneous sterile polyether sponge (type 611-9) disc (15×5×5 mm) under the dorsal skin at day 0. Test reagents were injected through the skin directly into the sponges every second day for 21 days (100 μl injection volume). Groups of 2 mice received either PBS control; 10 ng / ml basic fibroblast growth factor (bFGF); or 10 ng / ml bFGF+100 μg / ml MR ectodomain. Animals were scarified on day 21 and sponge's were removed, fixed in 3.7% paraformaldeyde and paraffin embedded. 5 micron sections were stained with haematoxylin and eosi...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

PropertyMeasurementUnit
Volumeaaaaaaaaaa
Fractionaaaaaaaaaa
Densityaaaaaaaaaa
Login to view more

Abstract

A method of inhibiting angiogenesis in an individual in need thereof comprising administering an antibody that selectively binds to the extracellular region of human magic roundabout (MR) to the individual. An antibody that has the amino acid sequences i) to iii), the amino acid sequences iv) to vi), or the amino acid sequences i) to vi): i) S A S S S V S Y M Y ii) L T S N L A S iii) Q Q W S S N P L T iv) D Y N L N v) V I N P N Y G T T S Y N Q K F K G vi) G R D Y F G Y. A method of inhibiting angiogenesis in an individual in need thereof comprising administering the extracellular domain (residues 1-467) of MR, or a fragment thereof that inhibits angiogenesis, to the individual. A method of inhibiting endothelial cell migration and/or proliferation comprising administering the extracellular domain of MR, or a fragment thereof that inhibits endothelial cell migration and/or proliferation.

Description

RELATED APPLICATIONS [0001] This application is a continuation of U.S. application Ser. No. 10 / 535,873, filed Nov. 21, 2005, which is a National Stage of International Application No.: PCT / GB03 / 05059, filed Nov. 20, 2003, which claims priority to United Kingdom Application No.: 0321401.2, filed Sep. 12, 2003 and United Kingdom Application No.: 0227080.9, filed Nov. 20, 2002, the entire contents of which are hereby incorporated by reference.FIELD OF THE INVENTION [0002] The present invention relates to antibodies and polypeptides, and in particular to ECSM4 antibodies and polypeptides that inhibit angiogenesis and their use therefor. BACKGROUND OF THE INVENTION [0003] Endothelial cells form a single cell layer that lines all blood vessels and regulates exchanges between the blood stream and the surrounding tissues. New blood vessels develop from the walls of existing small vessels by the outgrowth of these endothelial cells which have the capacity to form hollow capillary tubes even ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
IPC IPC(8): A61K39/395A61K31/70A61P43/00C12N15/87C12N5/06A61P9/00A61P35/00C07K16/18C12N15/13
CPCA61K31/70A61K2039/505C07K2316/96C07K16/18C07K16/2803A61K2039/53C07K2317/76A61P15/00A61P17/06A61P19/02A61P27/02A61P29/00A61P35/00A61P3/04A61P43/00A61P9/00A61P9/10
Inventor BICKNELL, ROYSUCHTING, STEVENSTEWART, LORNA
Owner CANCER RES TECH LTD
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap