Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Nucleic acid adapter with high specificity and high affinity to human breast carcinoma tissue, preparation method and application thereof

A nucleic acid aptamer, high specificity technology, applied in the field of breast cancer diagnosis and targeted therapy, to achieve the effect of easy labeling and high stability

Inactive Publication Date: 2012-05-30
CHINA NAT ACAD NANOTECH & ENG +1
View PDF0 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

What is more noteworthy is that breast cancer can metastasize through direct infiltration, lymphatic, blood, etc., and its common metastatic sites are lung and pleura, bone, skin and soft tissue, liver, and brain. This is the main reason for the failure of the treatment of this disease, and it is also a very difficult problem in the prevention and treatment of breast cancer, causing a social burden of tens of billions of RMB

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Nucleic acid adapter with high specificity and high affinity to human breast carcinoma tissue, preparation method and application thereof
  • Nucleic acid adapter with high specificity and high affinity to human breast carcinoma tissue, preparation method and application thereof
  • Nucleic acid adapter with high specificity and high affinity to human breast carcinoma tissue, preparation method and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0053] Example 1: In vitro screening of nucleic acid aptamers specifically binding to human breast cancer

[0054] Use primer 1 and primer 2 to amplify the single-stranded DNA library: the concentration of primer 1 and primer 2 is 100 pmol, and the amplification conditions are: pre-denaturation at 94°C for 3 minutes, then denaturation at 94°C for 40 seconds, annealing at 65°C for 1 minute, and extension at 72°C for 2 minutes. Cycle 30 times, and finally extend for 7 minutes at 72°C. Combine the amplified dsDNA product labeled with biotin at the 5' end with streptavidin magnetic beads, hold at room temperature for 30 minutes, then act with 0.15 mol / L NaOH for 15 minutes to denature and melt the dsDNA, and obtain ssDNA by magnetic separation. Incubate at 95°C for 5 minutes, place in ice for 2 minutes, and place at room temperature for 10 minutes to form an ssDNA library. The pathological sections were routinely dewaxed to water, and the prepared ssDNA library was reverse-screen...

Embodiment 2

[0057] Example 2: In vitro screening of nucleic acid aptamers specifically binding to human breast cancer

[0058] Use primer 1 and primer 2 to amplify the single-stranded DNA library: use asymmetric PCR, the concentration ratio of primer 1 / primer 2 is 100:1, and the amplification conditions are: pre-denaturation at 94°C for 3 minutes, then denaturation at 94°C for 30 seconds, and annealing at 65°C for 45 seconds , cycled 35 times, extended at 72°C for 1 min, and finally extended at 72°C for 7 min. The obtained product is mainly ssDNA, reacted at 95°C for 3 minutes, placed in ice for 2 minutes, and left at room temperature for 10 minutes, which is the ssDNA library. Breast cancer pathological sections were routinely dewaxed to water, the prepared ssDNA library was reverse-screened with normal breast tissue, and then incubated with human breast cancer tissue. Use elution buffer (20mmol / L Tris-HCl, 4mol / L isothiocyanate, 1mmol / L DTT) to elute ssDNA from human breast cancer tiss...

Embodiment 3

[0061] Embodiment 3: The nucleic acid aptamer of screening is used for the detection of breast cancer

[0062] The positive clone plasmid with the screened sequence ATCCGCCTGATTAGCGATACTGACTCCCTCCATCTTCCCGGCTACACTGGTCAGGGACTTGAGCAAAATCACCTGCAGGGG was used as a template, and primers 3 and 4 were used for asymmetric PCR. The concentration ratio of primer 3 (100 pmol) / primer 4 was 200:1. Then denature at 94°C for 30 s, anneal at 65°C for 45 s, extend at 72°C for 1 min, cycle 35 times, and finally extend at 72°C for 7 min. The obtained product was mainly biotin-ssDNA, which was reacted at 95°C for 3 minutes, placed in ice for 2 minutes, and left at room temperature for 10 minutes, and used as a detection reagent for later use. Human breast cancer pathological sections were routinely dewaxed to water, a blank control group was set up, 0.3%H 2 o 2 - Block endogenous peroxidase with methanol solution for 30 minutes, wash with TBS for 5 minutes, incubate with the prepared DNA aptame...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The present invention relates to one kind of nucleic acid gamete with high specificity and affinity to human breast cancer tissue and its preparation process and application. The nucleic acid gamete includes one DNA sequence and one RNA sequence and may be combined to human breast cancer tissue specifically, so that it may be applied for diagnosis and targeting treatment of human breast cancer. The nucleic acid gamete has high specificity and affinity to human breast cancer tissue and no reaction to health mammary gland tissue. The present invention also relates to derived sequences, including modified sequence, of the nucleic acid gamete.

Description

(1) Technical field: [0001] The present invention relates to the field of biotechnology, in particular to the preparation of a group of nucleic acid aptamers with high specificity and high affinity for human breast cancer tissue by using the SELEX technology (that is, phylogenetic evolution index enrichment technology) in molecular biology technology, and the obtained The nucleic acid aptamer-derived sequence and modified sequence are used for the diagnosis and targeted therapy of breast cancer. (two) background technology: [0002] Breast cancer is the malignant tumor with the highest incidence rate among women in the world. According to authoritative medical statistics, one person dies of breast cancer every 13 minutes in the world. Breast cancer has become an important disease that seriously threatens women's health. With the development of the national economy and the improvement of people's living standards, the incidence and mortality of breast cancer in my country are...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C12N15/12C07H21/04C12Q1/68A61K31/7088A61K48/00A61P35/00
Inventor 吴淑庆弓景波
Owner CHINA NAT ACAD NANOTECH & ENG
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com