Transcriptional regulation protein, preparation and use thereof
A transcriptional regulation and protein technology, applied in the fields of molecular biology and genetic engineering, can solve the problem of reducing bacterial virulence, and achieve the effect of reducing bacterial virulence and the method is novel and effective
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Examples
Embodiment 1
[0027] The tarda edwardia hemolysin gene transcription regulator protein EthR of the present invention has the base sequence of ethR in SEQ ID No.1 of the sequence table.
[0028] Sequence Listing 1
[0029] ATGCAACTAAATGCTCAAACAACAAGCCGCCCAGCGCAACCTCTCCTATCTTCTTGCTGAGAAGATAGGCCAGCGGATCCT
[0030] GTCCGGTGAATATCAGTCCGGCAGCATTCTGCCGGGGGAACTCGAACTGGGTGAGATCTATGGCGTCAGCCGCACCGCTG
[0031]TACGTGAGGCGGTAAAAATGCTGGCGGCCAAAGGTATGCTGCTACCGCGTCCGCGCATTGGTACGCGCGTCATGCCGAGC
[0032] AGCAGCTGGAATTTTCTCGATCAGGAGCTGCTGACCTGGTGGCTGACCCGAGAGAATTTTGAACACGTCAAAAGATCACTT
[0033] CCTGGTGCTGCGCAATGCGCTGGAGCCACAGGCCTGCCTGCTGACGGCGCTGCACGCCAGCGGCACCGATAAAGCCGTTA
[0034] TCAATAACCTGATGCATGAAATGCGCGAGCTCAATAGCCATTTTGATCGCGAACGCTGGATTCGGGTCGATGTACAATTC
[0035] CACCAGCAAATCTACAAGGCCAGCGCTAACCCGTTCCTGACCTCGTTCTCCAACTTGTTCAACTCGGTCTACCAAAGCTA
[0036] CTTCCGTTCGGTAACCGGTAATGAAGTCGTCAAGCTGGAGCAGCACCAGGCGATCGTCGATGCCATCCTCGCCGGCGACG
[0037] CCCAGGGGGCCTATGTGGCCTGTCAGGGTTGCTGGGTATAGACGGAGCCTAA
...
Embodiment 2
[0052] The antisense RNA interferes with the transcriptional regulatory protein having the base sequence of SEQ ID No. 1 in the sequence table so that it has the effect of reducing bacterial virulence.
[0053] The expression interference method of the transcriptional regulatory protein:
[0054] 1) Construction of plasmid pBTR1: Using plasmid pTrcHis (purchased from Invitrogen, USA) as a template, PCR with the following primers: TRF1 (5'- GAATTC ATTAATCACTGCATAATTCGTG-3', the underlined base is the EcoRI site), TRR1 (5'- GGATCC AT GATATC ATTATACGAGCCGGATG-3', the underlined base is the BamHI / EcoRV site), the PCR conditions are: 94°C 60s pre-denatured template DNA, then 94°C 40s, 48°C 60s, 72°C 60s, after 5 cycles, change to 94°C 40s, 57°C for 60s, 72°C for 60s, 25 cycles and then extended reaction at 72°C for 10min. The PCR product was purified with the Tiangen DNA Product Purification Kit and ligated with the PCR cloning vector pBS-T (purchased from "Tiangen Biochemical...
Embodiment 3
[0065] The difference from the preparation of the transcriptional regulatory protein in Example 1 is:
[0066] 1) Construction of plasmid pBTWF1: The PCR amplification product was ligated with the carrier pBS-T for 4 hours at room temperature, and the ligation mixture was transformed into Escherichia coli DH5α and cultured on LB solid medium containing Ap, Xgal and IPTG for 24 hours, and the white The transformants were extracted with a plasmid, namely the plasmid pBTWF1.
[0067] 2) Construction of plasmid pBTWF2: The two recovered fragments were ligated with T4 DNA ligase at 16°C for 16 hours, and the ligation solution was transformed into Escherichia coli DH5α and cultured on LB solid medium containing Ap for 24 hours.
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More