Unlock instant, AI-driven research and patent intelligence for your innovation.

Transcriptional regulation protein, preparation and use thereof

A transcriptional regulation and protein technology, applied in the fields of molecular biology and genetic engineering, can solve the problem of reducing bacterial virulence, and achieve the effect of reducing bacterial virulence and the method is novel and effective

Inactive Publication Date: 2014-04-09
INST OF OCEANOLOGY - CHINESE ACAD OF SCI
View PDF0 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Since Eth hemolysin is an important virulence factor and is closely related to bacterial virulence, its expression is strictly regulated, and disrupting this regulation can lead to a reduction in bacterial virulence

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0027] The tarda edwardia hemolysin gene transcription regulator protein EthR of the present invention has the base sequence of ethR in SEQ ID No.1 of the sequence table.

[0028] Sequence Listing 1

[0029] ATGCAACTAAATGCTCAAACAACAAGCCGCCCAGCGCAACCTCTCCTATCTTCTTGCTGAGAAGATAGGCCAGCGGATCCT

[0030] GTCCGGTGAATATCAGTCCGGCAGCATTCTGCCGGGGGAACTCGAACTGGGTGAGATCTATGGCGTCAGCCGCACCGCTG

[0031]TACGTGAGGCGGTAAAAATGCTGGCGGCCAAAGGTATGCTGCTACCGCGTCCGCGCATTGGTACGCGCGTCATGCCGAGC

[0032] AGCAGCTGGAATTTTCTCGATCAGGAGCTGCTGACCTGGTGGCTGACCCGAGAGAATTTTGAACACGTCAAAAGATCACTT

[0033] CCTGGTGCTGCGCAATGCGCTGGAGCCACAGGCCTGCCTGCTGACGGCGCTGCACGCCAGCGGCACCGATAAAGCCGTTA

[0034] TCAATAACCTGATGCATGAAATGCGCGAGCTCAATAGCCATTTTGATCGCGAACGCTGGATTCGGGTCGATGTACAATTC

[0035] CACCAGCAAATCTACAAGGCCAGCGCTAACCCGTTCCTGACCTCGTTCTCCAACTTGTTCAACTCGGTCTACCAAAGCTA

[0036] CTTCCGTTCGGTAACCGGTAATGAAGTCGTCAAGCTGGAGCAGCACCAGGCGATCGTCGATGCCATCCTCGCCGGCGACG

[0037] CCCAGGGGGCCTATGTGGCCTGTCAGGGTTGCTGGGTATAGACGGAGCCTAA

...

Embodiment 2

[0052] The antisense RNA interferes with the transcriptional regulatory protein having the base sequence of SEQ ID No. 1 in the sequence table so that it has the effect of reducing bacterial virulence.

[0053] The expression interference method of the transcriptional regulatory protein:

[0054] 1) Construction of plasmid pBTR1: Using plasmid pTrcHis (purchased from Invitrogen, USA) as a template, PCR with the following primers: TRF1 (5'- GAATTC ATTAATCACTGCATAATTCGTG-3', the underlined base is the EcoRI site), TRR1 (5'- GGATCC AT GATATC ATTATACGAGCCGGATG-3', the underlined base is the BamHI / EcoRV site), the PCR conditions are: 94°C 60s pre-denatured template DNA, then 94°C 40s, 48°C 60s, 72°C 60s, after 5 cycles, change to 94°C 40s, 57°C for 60s, 72°C for 60s, 25 cycles and then extended reaction at 72°C for 10min. The PCR product was purified with the Tiangen DNA Product Purification Kit and ligated with the PCR cloning vector pBS-T (purchased from "Tiangen Biochemical...

Embodiment 3

[0065] The difference from the preparation of the transcriptional regulatory protein in Example 1 is:

[0066] 1) Construction of plasmid pBTWF1: The PCR amplification product was ligated with the carrier pBS-T for 4 hours at room temperature, and the ligation mixture was transformed into Escherichia coli DH5α and cultured on LB solid medium containing Ap, Xgal and IPTG for 24 hours, and the white The transformants were extracted with a plasmid, namely the plasmid pBTWF1.

[0067] 2) Construction of plasmid pBTWF2: The two recovered fragments were ligated with T4 DNA ligase at 16°C for 16 hours, and the ligation solution was transformed into Escherichia coli DH5α and cultured on LB solid medium containing Ap for 24 hours.

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to the molecular biology and the genetic engineering field, in particular to a genetic regulation protein of Edwardsiella tarda hemolysin and a preparation method and an application thereof. The protein has an base sequence listed in a sequence table of SEQ ID No.1. The Edwardsiella tarda TX1 is taken as a template and primers of ERFA and ERRA are adopted for PCR amplification; an amplified product is connected with a carrier pBS-T and conversed at the room temperature and the obtained plasmid pBTWF1 is cut by incision enzyme and 0.7kb segment is recycled; plasmid pBR 322 is cut by incision enzyme and 3.7kb segment is recycled. The two types of segments are connected by T4 DNA to enzyme and then conversed to an expression plasmid which contains transcriptional regulation protein of the base sequence listed in the sequence table of SEQ ID No.1. Through the interference of reverse RNA to the transcriptional regulation protein of the base sequence listed in the sequence table of SEQ ID No.1, the transcriptional regulation protein can be provided with the function of reducing bacteria virulence. The novel and powerful transcriptional regulation protein of the genetic regulation factor of the hemolysin pertains to the regulation protein of GntR family and the protein is firstly found to be in the regulation with the hemolysin genes.

Description

technical field [0001] The invention relates to the fields of molecular biology and genetic engineering, in particular to an Edwardsi tarda hemolysin gene regulatory protein and its preparation and application. Background technique [0002] Edwardsiella tarda is an important pathogen of aquaculture animals, which can infect a variety of cultured fresh and marine fish, such as carp, tilapia, flounder, eel, fin fish, red sea bream, etc. The currently discovered pathogenic factors of Edwardsiella tarda mainly include three and six secretion systems, hemolysin and adhesin. The Eth hemolysin system is composed of EthA and EthB; EthA is a hemolysin factor that can directly interact with host cells to cause hemolysis; EthB is the transport and activation factor of EthA, so the secretion and functional activity of EthA depend on EthB. Since Eth hemolysin is an important virulence factor closely related to bacterial pathogenicity, its expression is strictly regulated, and the destru...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C07K14/195C12N15/31C12N15/70C12N1/21C12N15/11C12N15/113
Inventor 孙黎王芳张敏
Owner INST OF OCEANOLOGY - CHINESE ACAD OF SCI