Check patentability & draft patents in minutes with Patsnap Eureka AI!

Listeria monocytogenes detection kit and detection method thereof

A technology of Listeria monocytogenes and a detection kit, which is applied in the direction of biochemical equipment and methods, and the determination/inspection of microorganisms, can solve the problems of cumbersome detection steps, low sensitivity, and single detection samples, so as to improve the detection rate And sensitivity, high sensitivity, reduce the effect of the cultivation process

Inactive Publication Date: 2009-03-11
SHANGHAI ENTRY EXIT INSPECTION & QUARANTINE BUREAU OF P R C
View PDF0 Cites 11 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0005] The purpose of the present invention is to provide a test kit for rapid detection of Listeria monocytogenes in samples, which mainly solves the technical problems of single detection samples, cumbersome detection steps and low sensitivity in the existing test kits for detecting Listeria monocytogenes

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Listeria monocytogenes detection kit and detection method thereof
  • Listeria monocytogenes detection kit and detection method thereof
  • Listeria monocytogenes detection kit and detection method thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment Construction

[0038] Mock samples: minced pork and vegetables were detected with a kit for rapid detection of Listeria monocytogenes in samples. The kit consists of:

[0039] Reagent A: Pretreatment sample solution. Its composition is 0.1mol / L NaCl, 0.02mol / L CaCl 2 , 0.1% Tween, 0.05% mg / mL trypsin, 25mg / mL mannose, 25mg / mL glucose;

[0040] Reagent B: Magnetic beads with a diameter of 250 nm. Consists of Anti-Listeria (anti-Listeria) coated antibodies;

[0041] Reagent C: DNA extraction solution. Its composition is 20% SDS, phenol: chloroform: isoamyl alcohol volume ratio=25:24:1; Chloroform: isoamyl alcohol volume ratio=24:1;

[0042] Reagent D: PCR reaction solution, containing 5 μL 0.025mol / L MgCl in each tube of Listeria monocytogenes 50 μL amplification reaction system composition 2 5pmol / L2 for primers A08650 and A08651, 3μL, A08653 and A08654 for 8μL; PCR buffer 5μL; 200μmol / L dNTP 1μL; Taq enzyme 0.5μL; DNA 10μL (final concentration 2ng / mL); ddH 2 O 6.5 μL;

[0043] Accord...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
concentrationaaaaaaaaaa
diameteraaaaaaaaaa
Login to View More

Abstract

The invention relates to a device and method for detecting Listeria monocytogenes in a sample. The method mainly solves the technical problem that the prior Liseria monocytogene detection kit can detect a single sample and has complicated detection procedures and low sensitivity. The kit contains the following reagents: a reagent A, which is a sample pretreatment solution; a reagent B, which contains magnetic beads; a reagent C, which is a DNA extracting solution; a reagent D, which is a PCR reaction solution containing two pairs of specific primers which are A08650 and A08653, and A08653 andA08654. the sequences of the two pairs of specific primers are 5'GGGGAACCCACTATCTTTAGTC and 5'GGGCCTTTCCAGACCGCTTCA, and 5' GCCTGCAAGTCCTAAGACGCCAATC and 5' CTTGCAACTGCTCTTTAGTAACAGC, respectively. The method is maily used for rapid detection of Listeria monocytogeners in the sample.

Description

[0001] Technical field: the present invention relates to a detection device and a detection method for Listeria monocytogenes in a sample. In particular, it relates to a detection kit for Listeria monocytogenes and a detection method thereof. Background technique: [0002] Listeria monocytogenes (abbreviated as Lmonocytogenes, LMO) is a zoonotic pathogen that can cause meningitis, encephalitis, sepsis, miscarriage and stillbirth in pregnant women and other animals. disease, the mortality rate is as high as 30% to 70%. The disease is widely present in soil, human and animal feces, and it is easy to contaminate food and cause outbreaks of food poisoning and listeriasis. In recent years, many countries have reported food poisoning incidents caused by contamination of Listeria monocytogenes. As early as 1929, it was reported that the bacterium was pathogenic to humans. The most serious one was food poisoning caused by Listeria monocytogenes caused by eating cheese in the Califor...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12Q1/68C12Q1/04
Inventor 李晓虹黄逸男蒋琴娣
Owner SHANGHAI ENTRY EXIT INSPECTION & QUARANTINE BUREAU OF P R C
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More