Patents
Literature
Patsnap Eureka AI that helps you search prior art, draft patents, and assess FTO risks, powered by patent and scientific literature data.

53 results about "Genus Listeria" patented technology

Listeria is a genus of bacteria that, until 1992, contained 10 known species, each containing two subspecies. As of 2014, another five species were identified. Named after the British pioneer of sterile surgery Joseph Lister, the genus received its current name in 1940.

Listeria-based EphA2 vaccines

InactiveUS20050281783A1Beneficial therapeuticBeneficial prophylactic benefitBiocideSenses disorderCancer preventionCancer therapy
The present invention relates to methods and compositions designed for the treatment, management, or prevention of cancer, particularly metastatic cancer and cancers of T cell origin, and hyperproliferative diseases involving EphA2-expressing cells. The methods of the invention entail the use of a Listeria-based EphA2 vaccine. The invention also provides pharmaceutical compositions comprising one or more Listeria-based vaccines of the invention either alone or in combination with one or more other agents useful for cancer therapy. In certain aspects of the invention, the methods entail eliciting both CD4+ and CD8+ T-cell responses against EphA2 and / or EphA2-expressing cells.
Owner:CERUS CORP

Methods for constructing antibiotic resistance free vaccines

ActiveUS20060104991A1Bacterial antigen ingredientsBacteriaHeterologousHeterologous Antigens
The present invention provides Listeria vaccine strains that express a heterologous antigen and a metabolic enzyme, and methods of generating same.
Owner:THE TRUSTEES OF THE UNIV OF PENNSYLVANIA

Annular mediated isothermal amplification-nano cadmium sulphide mark electrochemistry checking method for Listeria monocytogenes

The invention relates to a method for detection Listeria monocytogenes with loop-mediated isothermal amplification-CdS nanoparticles labeling electrochemistry. The method is characterized in that the method comprises the following steps of: obtaining double-stranded target sequence of amplification reagent-Listeria monocytogenes to be detected by means of loop-mediated isothermal amplification reaction; pyrolyzing a double-stranded target sequence in water bath into a single-stranded target sequence, then self assembling and fixing at the surface of gold electrode, so that the target sequence modified electrode of the Listeria monocytogenes to be detected is obtained; afterwards, labeling the probe sequence coming from the Listeria monocytogenes by CdS nanoparticles to obtain a labeled probe sequence; carrying out molecular hybridization on the labeled probe sequence and the target sequence of the target sequence modified electrode, and carrying out electrochemical detection by simultaneity plating Hg anodic stripping method; detecting out cadmium ions corresponding to the species-specific genes (actA) of the detected Listeria monocytogenes. The method has the advantages of speediness, strong specificity, high sensitivity and convenient use.
Owner:QINGDAO UNIV OF SCI & TECH

Plating media for the presumptive identification of Listeria sp, Listeria monocytogenes and Listeria ivanovii

InactiveUS20070259393A1Increase intensity colorMaterial can be affectedBacteriaUnicellular algaeListeria seeligeriAlglucerase
Isolation plating medium of a first color for the identification of Listeria sp. and Listeria monocytogenes and Listeria ivanovii containing a first chromogenic substrate that responds to phosphatidylinositol-specific phospholipase C enzymes to release precipitate of a second color into the medium and a second chromogenic substrate that responds to beta-glucosidase enzymes to release precipitate of a third color into the medium, and said first, second and third colors contrasting with each other.
Owner:R&F PROD

Oligonucleotide probe kit for detecting common intestine trac kpathogenic bacteria and its use

The present invention belongs to the field of microbe detecting technology. The oligonucleotide probe for detecting common intestinal tract pathogenic bacteria is designed on 16S rRNA and 23S rRNA of bacteria, ipaH of dysentery bacillus giant plasmid, VipR of Salmonella typhi and other gene sequence, has length of 25-50 bp, and relatively high sensitivity and specificity. The oligonucleotide probe is suitable for detection based on nucleic acid hybridization principle, especially detection based on gene chip principle. Under certain use condition, it can detect Listeria, parahemolutic vibrio, Campylobacter, etc. It may be used in many aspects, such as disease diagnosis, environment detection, food poisoning detection, etc.
Owner:RADIOLOGY INST ACAD OF MILITARY MEDICINE SCI PLA

Oligonucleotides for detecting listeria spp. and use thereof

An oligonucleotide specifically binding to 23S rRNA gene of Listeria spp., and a kit and a method of efficiently detecting Listeria spp. in a sample by using the oligonucleotide are provided.
Owner:SAMSUNG TECHWIN CO LTD

Virulent phages to control listeria monocytogenes in foodstuffs and in food processing plants

ActiveUS20050175594A1Shorten the counting processGrowth inhibitionAntibacterial agentsBiocideBiotechnologyBacteroides
The present invention relates to virulent (lytic) Listeria monocytogenes phage from the Myoviridae family, preferably P100, alone or in combination with other virulent phages. P100 and the endolysin from P100 can be administered to food products, to the components that will be added to food products, and / or to the infrastructure of the food processing plants within which such food products are processed, or the containers or wraps in which such foods are stored and / or shipped, in order to reduce Listeria monocytogenes contamination. P100 can also be used in the present invention to identify Listeria monocytogenes bacteria present on (or within) foodstuffs, as well as those Listeria monocytogenes bacteria present in the equipment or the general environment of the food processing plants in which the foodstuffs are being processed and in animals infected with Listeria monocytogenes. The phage and the endolysin of the present invention can also be used to treat animals infected with Listeria monocytogenes. P100 will kill the bacteria that are within its host range with great efficiency and will propagate to high titer thereon. P100 can be combined with other lytic phage, and / or with other antimicrobial agents to reduce or eliminate Listeria.
Owner:EBI FOOD SAFETY

Antimicrobial composition for pre-harvest and post-harvest treatment of plants and animals

An antimicrobial, anti-bacterial processing aid, food additive and food ingredient is provided to inhibit cellular growth of known pathogenic, indicator and spoilage organisms, such as salmonella, stahphylococcus, listeria, e coli, and the like. The antimicrobial agent of the present invention is useful as a treatment for animal feed, a treatment for pre-harvest and post-harvest processing of foodstuffs, a treatment for cooked food subject to airborne contaminants and many other conditions in need of disinfectants and sanitizers. One of the primary benefits of the antimicrobial agent is that it inhibits the growth of bacteria that have become antibiotic resistant.
Owner:CMS TECH +1

Detection of microbial metabolites with a 3-indoxyl-myo-inositol-1-phosphate compound

InactiveUS6068988ADisadvantageous effect stabilityGood colorSugar derivativesHydrolasesPhosphoric acidBacillus cereus
A method of detecting a phosphatidylinositol-specific phospholipase C enzyme by means of a substrate which is cleaved by said enzyme and yields a dye when the chromophoric portion of the substrate is dimerized and oxidized; the invention teaches using in such method, as a novel substrate, a 3-indoxyl-myo-inositol-1-phosphate compound of formula (I) wherein R is selected from the group consisting of hydrogen and C1-4 alkyl, while R1, R2, R3, and R4 are radicals selected from the group consisting of hydrogen, halogen, cyano, nitro, carboxy, amino, alkyl-substituted amino and sulphonyl; or of a salt of said formula I compound. The invention provides for a safe and sensitive method of detection of potentially pathogenic bacterial activity of such microbes as Bacillus cereus, B. Thuringiensis, Staphy lococcus aureus and various Listeria strains in potentially infected materials including physiological samples or consumable goods such as foods and beverages.
Owner:BIOSYNTH

Method for checking monocyte hyperplasia Listeria

The invention discloses a method for detecting viable Listeria monocytogene, relating to a method for detecting Listeria. The invention solves the problem that the prior method for detecting viable Listeria monocytogenes is easy to produce false positive. The method for detecting viable Listeria monocytogenes is carried out as following steps: after extracting bacterial sludge from articles to be detected, extracting RNA to implement retrotransposon and real time PCR; accordingly, a collection of illustrative plates which are capable of determining whether the articles contain viable Listeria monocytogenes or not. The method has the advantages of high sensitivity, good specificity, simple operation, and comparatively short period. The method meets the requirements of pathogen rapid detection in food industry.
Owner:NORTHEAST AGRICULTURAL UNIVERSITY

Double-antibody sandwich ELISA (enzyme-linked immuno sorbent assay) method for detecting listeria in food on basis of monoclonal antibodies

The invention discloses a double-antibody sandwich ELISA (enzyme-linked immuno sorbent assay) method for detecting listeria in food on the basis of monoclonal antibodies, belonging to the technical field of immunoassay. The method comprises the following steps: immunizing 8-week BALB mouse with prokaryotically expressed listeria monocytogenes P60 protein, and obtaining 15 strains of listeria specific monoclonal antibodies by immunization, fusion and multiple screening; respectively marking horse radish peroxidase HRP, and carrying out pairwise coupling by taking the listeria monocytogenes CMCC54003 as targets. The sandwich ELISA method which is established by screening different paired cross reactions and taking 2G7 as a coating antibody and 2H8-HRP as an enzyme labelled antibody has cross reactions to listeria including the listeria monocytogenes, and has no cross reactions to tested staphylococcus aureus, escherichia coli, escherichia coli O157, salmonella, enterobacter sakazakii, campylobacter jejuni and campylobacter coli. According to the method disclosed by the invention, the monoclonal antibodies having listeria specificity are prepared and the double-antibody sandwich ELISA method is established, and the method provides a technical means for specific rapid detection of the listeria in food.
Owner:JIANGNAN UNIV

Listeria monocytogenes detection kit and detection method thereof

The invention relates to a device and method for detecting Listeria monocytogenes in a sample. The method mainly solves the technical problem that the prior Liseria monocytogene detection kit can detect a single sample and has complicated detection procedures and low sensitivity. The kit contains the following reagents: a reagent A, which is a sample pretreatment solution; a reagent B, which contains magnetic beads; a reagent C, which is a DNA extracting solution; a reagent D, which is a PCR reaction solution containing two pairs of specific primers which are A08650 and A08653, and A08653 andA08654. the sequences of the two pairs of specific primers are 5'GGGGAACCCACTATCTTTAGTC and 5'GGGCCTTTCCAGACCGCTTCA, and 5' GCCTGCAAGTCCTAAGACGCCAATC and 5' CTTGCAACTGCTCTTTAGTAACAGC, respectively. The method is maily used for rapid detection of Listeria monocytogeners in the sample.
Owner:SHANGHAI ENTRY EXIT INSPECTION & QUARANTINE BUREAU OF P R C

Site specific listeria integration vectors and methods for using the same

InactiveUS20070059322A1Antibacterial agentsBiocideHeterologous AntigensIntegrases
Site-specific Listeria integration vectors and methods for their use are provided. The subject vectors include a bacteriophage integrase gene and a bacteriophage attachment site, where in many embodiments the bacteriophage that is the source of these elements is a listeriophage. In certain embodiments, the subject vectors further include a multiple cloning site, where the multiple cloning site may further include a polypeptide coding sequence, e.g., for a heterologous antigen. The subject vectors and methods find use in a variety of different applications, including the study of Listeria species and the preparation of Listeria vaccines.
Owner:RGT UNIV OF CALIFORNIA

Microorganisms as carriers of nucleotide sequences coding for antigens and protein toxins, process of manufacturing and uses thereof

ActiveUS8669091B2Efficient tumor therapyEnhance immune responseAntibacterial agentsBacteriaAntigenTransport system
A Escherichia, Salmonella, Yersinia, Vibrio, Listeria, Shigella, or Pseudomonas bacterium that has the following components: (I) a polynucleotide encoding a heterologous antigenic determinant that induces a CTL response against a tumor cell; (II) a polynucleotide encoding a heterologous protein toxin or toxin subunit; and (III) (a) a polynucleotide encoding a transport system that expresses the products of (I) and (II) on the outer surface of the bacterium or that secretes products of (I) and (II) from the bacterium; and (IV) a polynucleotide that activates the expression of one or more of (I). (II), and / Or (III) in the bacterium wherein polynucleotides (I), (II), (III) and (IV) are different from each other and polynucleotides (I), (II) and (III) encode proteins that are different from each other.
Owner:SOCIUM THERAPEUTICS INC

Dual delivery system for heterologous antigens

Provided herein are recombinant Listeria strains expressing a tumor-specific antigenic polypeptide and, optionally, an angiogenic polypeptide wherein a nucleic acid molecule encoding at least one of the polypeptides is operably integrated into the Listeria genome in an open reading frame with a nucleic acid sequence encoding a PEST-containing polypeptide, methods of preparing same, and methods of inducing an immune response, and treating, inhibiting, or suppressing cancer or tumors comprising administering same.
Owner:ADVAXIS

Selective growth medium for Listeria spp

ActiveUS7960164B2Quick and accurate identificationBacteriaMicrobiological testing/measurementBacteroidesLithium chloride
The invention is a selective growth medium for investigating, isolating, counting and directly identifying pathogenic bacteria of the genus Listeria.The medium promotes the Listeria spp. while simultaneously inhibiting the growth of non-Listeria organisms. The medium does not produce a bacterial biomass contaminated with interfering fluorophores. The medium contains nitrofurantoin, esculin and lithium chloride and lacks acriflavin.
Owner:PARADIGM DIAGNOSTICS

Probiotic strains from Lactobacillus salivarius and antimicrobial agents obtained therefrom

InactiveUS20040038379A1Antibacterial agentsMilk preparationBacteroidesCell free supernatant
A strain of Lactobacillus salivarius isolated from resected and washed human gastrointestinal tract inhibits a broad range of Gram positive and Gram negative microorganisms and secretes a product having antimicrobial activity into a cell-free supernatant. The activity is produced only by growing cells and is destroyed by proteinase K and pronase E, the inhibitory properties of the strain and its secretory products being maintained in the presence of physiological concentrations of human bile and human gastric juice. The strain exhibits a broad-spectrum of activity against bacteria including Listeria, Staphylococcus, including methocillin resistant St. aureus (MRSA), and Bacillus, but does not inhibit many closely related lactobacilli. An antimicrobial agent is obtained from the strain which has bacteriocin-like properties.
Owner:ENTERPRISE IRELAND & UNIV COLLEGE CORK +1

Monocyte hyperplasia Listeria PCR detecting method adding amplified interior label

The invention relates to a detection method of Listeria monocytogenes PCR with monocyte hyperplasia used for adding internal amplification control for food safety, pertaining to the biological technical field. The invention comprises the steps: a section of internal amplification control sequence is synthesized artificially, and corresponding special primers are designed; the concentration of MgCl2 and the anneal temperature are optimally selected; PCR testing and comparison are made to choose an adding concentration which has least effect to detection sensitivity and is capable of clearly indicating the concentration of the internal amplification control of false negative; whether the specific and the internal amplification control of primers can be normally enlarged in the testing of a Listeria monocytogenes sample with the monocyte hyperplasia can be determined; the stability of a PCR testing system is estimated through interference-free experiments; whether the false negative of the internal amplification control is indicated or not is judged by testing the artificial pollution sample; the accuracy of the testing result of the PCR testing system is estimated. The invention improves the accurate rate of the PCR testing and provides effective and reliable technical means to investigate and test food-borne pathogenic bacteria required during quarantine and law enforcement process.
Owner:SHANGHAI JIAO TONG UNIV

Colloidal gold test paper strip for detecting Listeria or Listeria monocytogenes in food based on monoclonal antibody, and applications thereof

InactiveCN106093410AUniformity testNo cross reactionMaterial analysisColloidGenus Listeria
The invention relates to a colloidal gold test paper strip for detecting Listeria or Listeria monocytogenes in food based on monoclonal antibody, and applications thereof, and belongs to the technical field of immunological analysis. According to the colloidal gold test paper strip, a sample pad, a nitrocellulose membrane and a water absorbing pad are sequentially arranged on a PVC bottom plate; the gold-labeled antibody is the colloidal gold solution of antibody 2H8 when the Listeria in the food is detected based on the monoclonal antibody; and the gold-labeled antibody is the colloidal gold solution of antibody A when the Listeria monocytogenes in the food is detected based on monoclonal antibody. According to the present invention, the colloidal gold test paper strip for detecting the Listeria or the Listeria monocytogenes in the food based on the monoclonal antibody is developed, and is suitable for the high-specificity, high-accuracy, high-sensitivity, rapid and convenient analysis of the Listeria or the Listeria monocytogenes in the food.
Owner:JIANGNAN UNIV

Food-poisoning bacteria detection carrier, and method for detecting food-poisoning bacteria

The disclosed method simultaneously and specifically detects at least two types of food-poisoning bacteria from among Escherichia coli, Listeria, Campylobacter, Vibrio parahaemolyticus, Staphylococcus aureus, Salmonella, and Bacillus cereus. The food-poisoning bacteria detection carrier immobilizes one or at least two probes selected from each of at least two groups from among: an E. coli-detecting first probe group comprising the probes of sequence numbers 1-6 and probes (hereinafter written as "and the like") that are complementary thereto; a Listeria-detecting second probe group comprising the probes of sequence numbers 7-13, and the like; a Campylobacter-detecting third probe group comprising the probes of sequence numbers 14-19, and the like; a Vibrio parahaemolyticus-detecting fourth probe group comprising the probes of sequence numbers 20-24, and the like; a Staphylococcus aureus-detecting fifth probe group comprising the probes of sequence numbers 25-29, and the like; a Salmonella-detecting sixth probe group comprising the probes of sequence numbers 30-40, and the like; and a Bacillus cereus-detecting seventh probe group comprising the probes of sequence numbers 41-49.
Owner:TOYO SEIKAN KAISHA LTD +1

Combination Therapies With Recombinant Listeria Strains

InactiveUS20180153974A1Enhanced anti-tumor T cell responseAntibody mimetics/scaffoldsFusion with degradation motifTransfer cellGenus Listeria
The disclosure is directed to compositions comprising an oncolytic virus, chimeric antigen receptor T cells (CAR T cells), a therapeutic or immunomodulating monoclonal antibody, a targeting thymidine kinase inhibitor (TKI), or an adoptively transferred cells incorporating engineered T cell receptors, and a live attenuated recombinant Listeria strain comprising a fusion protein of a Truncated LLO, a truncated ActA or a PEST-sequence peptide fused to a tumor-associated antigen. The disclosure is further directed to methods of treating, protecting against, and inducing an immune response against a tumor, comprising the step of administering the same, with or without an additional radiation therapy treatment.
Owner:THE TRUSTEES OF THE UNIV OF PENNSYLVANIA +1

Enrichment of Listeria spp

A medium for enriching Listeria spp. without polymerase chain reaction (PCR) inhibition and a method of using the medium.
Owner:HANWHA AEROSPACE CO LTD

Combination of listeria-based vaccine with anti-OX40 or anti-GITR antibodies

Disclosed herein are compositions comprising use of compositions comprising a live attenuated recombinant Listeria strain comprising a fusion protein of a truncated listeriolysin O (LLO) protein, a truncated ActA protein, or a PEST amino acid sequence fused to a heterologous antigen, including a tumor-associated antigen, wherein the compositions further comprise or are co-administered with an antibody or fragment thereof. Also disclosed are combination therapies comprising use of these compositions comprising live attenuated recombiant Listeria strains, in conjuction with an antibody or fragment thereof for use in treating, protecting against, and / or inducing an immune response against a tumor, especially wherein the treating, protection against and / or inducing an immune response increases percent survival in a subject.
Owner:ADVAXIS +1

Virulent phages to control Listeria monocytogenes in foodstuffs and in food processing plants

The present invention relates to virulent (lytic) Listeria monocytogenes phage from the Myoviridae family, preferably P100, alone or in combination with other virulent phages. P100 and the endolysin from P100 can be administered to food products, to the components that will be added to food products, and / or to the infrastructure of the food processing plants within which such food products are processed, or the containers or wraps in which such foods are stored and / or shipped, in order to reduce Listeria monocytogenes contamination. P100 can also be used in the present invention to identify Listeria monocytogenes bacteria present on (or within) foodstuffs, as well as those Listeria monocytogenes bacteria present in the equipment or the general environment of the food processing plants in which the foodstuffs are being processed and in animals infected with Listeria monocytogenes. The phage and the endolysin of the present invention can also be used to treat animals infected with Listeria monocytogenes. P100 will kill the bacteria that are within its host range with great efficiency and will propagate to high titer thereon. P100 can be combined with other lytic phage, and / or with other antimicrobial agents to reduce or eliminate Listeria.
Owner:EBI FOOD SAFETY