RNA probe for detecting novel coronavirus 2019-nCOV as well as preparation method and application thereof
A 2019-ncov, RNA probe technology, applied in biochemical equipment and methods, DNA/RNA fragments, recombinant DNA technology, etc., can solve the problems of RNA loss, RNA loss, false positive phenomenon, etc., to avoid RNA Losses, time savings, and improved accuracy
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0054] Embodiment 1. The preparation method of the RNA probe that detects 2019-nCOV.
[0055] Proceed as follows:
[0056] 1) Design primers: According to the base sequence of the 2019-nCOV region to be tested, use Premier 5.0 software and NCBI BLAST analysis to design primers to obtain primers COVID-19-F1 and COVID-19-R1;
[0057] COVID-19-F1: TTGTATTGACTGTAGTGCGCG, as shown in SEQ ID NO.2;
[0058] COVID-19-R1: ATAGAGCCATCCATGAGCACA, as shown in SEQ ID NO.3;
[0059] At the 5' end of the COVID-19-R1 primer, a T7 RNA polymerase promoter was added to obtain the primer COVID-19-R2;
[0060] COVID-19-R2: GCGTAATACGACTCACTATAGGGATAGAGCCATCCATGAGCACA, as shown in SEQ ID NO.4; wherein TAATACGACTCACTATA is the T7 RNA polymerase promoter sequence.
[0061] The base sequence of the 2019-nCOV region to be tested is (sequence synthesized by Gene Company):
[0062] TTGTATTGACTGTAGTGCGCGTCATATTAATGCGCAGGTAGCAAAAAGTCACAACA TTGCTTTGATATGGAACGTTAAAGATTTCATGTCATTGTCTGAACAACTACGAAAAC AAATA...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More - R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com



