Unlock instant, AI-driven research and patent intelligence for your innovation.

Method for rescuing influenza virus and bidirectional transcription vector special therefor

A technology of influenza virus and carrier, applied in the direction of virus/bacteriophage, using carrier to introduce foreign genetic material, antiviral agent, etc., can solve the problem of RNA instability and difficult operation

Inactive Publication Date: 2011-07-20
MICROBE EPIDEMIC DISEASE INST OF PLA MILITARY MEDICAL ACAD OF SCI
View PDF0 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Since the replication cycle of influenza A virus does not go through the DNA stage, the structural characteristics and instability of RNA make it difficult for people to directly manipulate the RNA virus genome at the molecular level

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Method for rescuing influenza virus and bidirectional transcription vector special therefor
  • Method for rescuing influenza virus and bidirectional transcription vector special therefor
  • Method for rescuing influenza virus and bidirectional transcription vector special therefor

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0039] Embodiment 1, construction of bidirectional transcription vector pZL2006

[0040] The present invention is achieved through the following technical solutions: use Hela cells to amplify the promoter (PIh) sequence of human RNA polymerase I (human polI), artificially synthesize the terminator sequence (tI) of RNA polymerase I, utilize BsmBI to The RNA polymerase I promoter and terminator are connected, and the RNA polymerase I promoter and terminator are reversely inserted into the pVAX1 plasmid to construct a bidirectional transcription vector. The specific method is as follows:

[0041] 1. PCR amplification of human polI promoter

[0042] Hela cell DNA was extracted according to the instructions of the Universal Genomic DNA Extraction KitVer: 3.0 kit from Takara Company. The PCR amplification of the human pol I promoter was carried out using pfu DNase from Promega Company, the amplification primers were POL1 (its sequence is GCGGTACCGTCTCCAATAACCCGGC) and POL2 (its se...

Embodiment 2

[0049] Embodiment 2, rescue influenza virus with bidirectional transcription vector of the present invention

[0050] 1. Construction of 8 fragment recombinant plasmids of influenza virus

[0051] According to the determined whole gene sequence of the human avian influenza virus strain in my country, primers for amplifying each gene fragment were designed. RT-PCR was used to amplify the corresponding gene segment of the virus from the extracted viral RNA, and connect to the PGEM T-Easy vector.

[0052] ①Preparation of influenza virus: Inoculate avian influenza virus A / Beijing / 01 / 2003 (H5N1) into SPF chicken embryos, culture influenza virus, collect 300ml of allantoic fluid, centrifuge at 6000rpm (30# rotor) for 15min, take supernatant, 18000rpm4 Centrifuge at ℃ for 1.5 h, and suspend the pellet with 40 ml of STE (10 mM pH8.0 Tris-HCl, 100 mM NaCl, 5 mM pH8.0 EDTA). Use 10% sucrose as the bottom, add the suspension carefully, centrifuge at 18000rpm 4℃ for 1.5h to remove impur...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
diameteraaaaaaaaaa
diameteraaaaaaaaaa
Login to View More

Abstract

The invention discloses a method for saving influenza virus and a dedicated bidirectional transcription vector thereof. The bidirectional transcription vector is an annular recombinant vector which is obtained by inserting the promoter and terminator of RNA polymerase I in the multiple cloning sites of pVAX1, and the terminator of the RNA polymerase I is positioned between the CMV promoter of thepVAX1 and the promoter of the RNA polymerase I. The bidirectional transcription vector and the method for saving influenza virus can be widely applicable to saving the influenza virus and preparing the influenza virus vaccine.

Description

technical field [0001] The invention relates to a method for rescuing influenza virus and its special bidirectional transcription carrier. Background technique [0002] In the 20th century, there have been at least four global pandemics of influenza viruses, which have killed tens of millions of people and caused huge disasters to mankind. The prevalence of influenza is related to the transmission intensity of influenza virus and the susceptibility to mutation of antigens. When new variants appear, people lack immunity to them, which symbolizes that a new epidemic is coming. Avian influenza virus is widely prevalent in all parts of the world and has been circulating in poultry for a long time. The fatality rate of highly pathogenic avian influenza virus to poultry is close to 100%. Since the H5N1 subtype of highly pathogenic avian influenza virus suddenly attacked humans in 1997, avian influenza has spread in many Asian countries from the end of 2003 to the beginning of 20...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C12N7/01C12N15/79C12N15/44A61P31/16A61K48/00
Inventor 祝庆余刘伯华张永国战大伟户义夏玉坤罗渊杨保安李靖
Owner MICROBE EPIDEMIC DISEASE INST OF PLA MILITARY MEDICAL ACAD OF SCI