Method for rescuing influenza virus and bidirectional transcription vector special therefor
A technology of influenza virus and carrier, applied in the direction of virus/bacteriophage, using carrier to introduce foreign genetic material, antiviral agent, etc., can solve the problem of RNA instability and difficult operation
- Summary
- Abstract
- Description
- Claims
- Application Information
 AI Technical Summary 
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0039] Embodiment 1, construction of bidirectional transcription vector pZL2006
[0040] The present invention is achieved through the following technical solutions: use Hela cells to amplify the promoter (PIh) sequence of human RNA polymerase I (human polI), artificially synthesize the terminator sequence (tI) of RNA polymerase I, utilize BsmBI to The RNA polymerase I promoter and terminator are connected, and the RNA polymerase I promoter and terminator are reversely inserted into the pVAX1 plasmid to construct a bidirectional transcription vector. The specific method is as follows:
[0041] 1. PCR amplification of human polI promoter
[0042] Hela cell DNA was extracted according to the instructions of the Universal Genomic DNA Extraction KitVer: 3.0 kit from Takara Company. The PCR amplification of the human pol I promoter was carried out using pfu DNase from Promega Company, the amplification primers were POL1 (its sequence is GCGGTACCGTCTCCAATAACCCGGC) and POL2 (its se...
Embodiment 2
[0049] Embodiment 2, rescue influenza virus with bidirectional transcription vector of the present invention
[0050] 1. Construction of 8 fragment recombinant plasmids of influenza virus
[0051] According to the determined whole gene sequence of the human avian influenza virus strain in my country, primers for amplifying each gene fragment were designed. RT-PCR was used to amplify the corresponding gene segment of the virus from the extracted viral RNA, and connect to the PGEM T-Easy vector.
[0052] ①Preparation of influenza virus: Inoculate avian influenza virus A / Beijing / 01 / 2003 (H5N1) into SPF chicken embryos, culture influenza virus, collect 300ml of allantoic fluid, centrifuge at 6000rpm (30# rotor) for 15min, take supernatant, 18000rpm4 Centrifuge at ℃ for 1.5 h, and suspend the pellet with 40 ml of STE (10 mM pH8.0 Tris-HCl, 100 mM NaCl, 5 mM pH8.0 EDTA). Use 10% sucrose as the bottom, add the suspension carefully, centrifuge at 18000rpm 4℃ for 1.5h to remove impur...
PUM
| Property | Measurement | Unit | 
|---|---|---|
| diameter | aaaaa | aaaaa | 
| diameter | aaaaa | aaaaa | 
Abstract
Description
Claims
Application Information
 Login to View More
 Login to View More - R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com
