Construction and screen method of novel RNA interference vector
An RNA interference and screening method technology, applied in the high-throughput construction of animal and plant RNA interference vectors, in the field of rapidity and high efficiency, can solve the problems of high experimental cost, low recovery and purification efficiency, cumbersome procedures, etc., to reduce the base error rate, The effect of saving experimental costs and simplifying experimental procedures
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0038] The invention is used to construct a plant artificial microRNA (amiRNA) expression vector which uses miR319a of Arabidopsis thaliana as the backbone and chalcone synthase (CHS) gene as the interference target gene.
[0039] 1) Transformation of the cloning vector
[0040] For the needs of subsequent experiments, the selected cloning vector is a donor plasmid that can be used in the mating-assisted genetically integrated cloning (MAGIC) method. After analysis, it was found that the plasmid DNA sequence carried two BfuI sites and one lacO sequence, the two BfuI sites were mutagenized into BamHI sites, and the lacO sequence was deleted and mutated. Insert the following fragments at the multiple cloning site of the transformed vector: "-promoter (P35S)-5' flanking sequence-BfuI site-gfp expression unit-BfuI site-lacO partial sequence-terminator (Tnos)- ", to obtain the transformation vector pDONOR-gfp. (See Figure 2 for details)
[0041] 2) Formation of artificial microR...
Embodiment 2
[0051] The invention is used to construct an animal artificial microRNA (amiRNA) carrier with mammalian miR30 as the backbone and agtagattaccactggagtct as the interference target sequence.
[0052] 1) Transformation of the cloning vector
[0053] The vector pBluescript SK(+) sequence was analyzed, and the BfuI site and lacO sequence on the sequence were mutagenized. Insert the following fragments at the multiple cloning site of the transformed vector: "-promoter (CMV)-5' flanking sequence-BfuI site-gfp expression unit-BfuI site-lacO partial sequence-terminator (SV40PolyA)- ".
[0054] 2) Formation of artificial microRNA-mir30-X containing interference target sequence
[0055] According to the principle in step 2) of the specific method of the present invention, analyze the miR30 sequence, design and synthesize a universal primer pUR and a pair of specific primers pF&pR, mix 3 primers, anneal at 25°C with Taq DNA polymerase, and extend at 72°C , the obtained product is mir30...
PUM

Abstract
Description
Claims
Application Information

- R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com