Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Toll-like receptor 9 (TLR9) blocking agent and application thereof

A blocker and receptor technology, applied in the direction of anti-inflammatory agents, non-central analgesics, medical preparations containing active ingredients, etc., can solve the problems of ambiguity, no effect, difference in effect intensity, etc., and achieve wide application Foreground, clear target, high blocking activity effect

Inactive Publication Date: 2011-11-23
THE FIRST AFFILIATED HOSPITAL OF THIRD MILITARY MEDICAL UNIVERSITY OF PLA
View PDF0 Cites 1 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0004] Although CpG-ODN is a clear TLR9 ligand, CpG-ODN with different structures still has different characteristics, which are mainly manifested in the following two aspects: one is species specificity, such as: (1) CpG-ODN1826 has different effects on mouse Immune cells have a strong stimulating effect, but have no effect on human immune cells; (2) CpG-ODN2216 has an effect on humans, but has no effect on mice; (3) CpG-ODN M362 has an effect on both; the second is the effect Intensity difference, the main stimulatory CpG-ODN fragment was found at the beginning, and later studies found that some CpG-ODN fragments are considered to have a neutralizing effect and can eliminate the inflammatory effect of stimulatory CpG-ODN. However, it is not clear whether it is through TLR9 antagonism The structural characteristics of these CpG-ODNs are not clear, and at the same time, there are no reports of anti-inflammatory and anti-allergic effects by blocking TLR9 receptors

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Toll-like receptor 9 (TLR9) blocking agent and application thereof
  • Toll-like receptor 9 (TLR9) blocking agent and application thereof
  • Toll-like receptor 9 (TLR9) blocking agent and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0030] Example 1 CpG-ODN-like TLR9 blocking agent example and preparation

[0031] 1.1 Blocker name: C41

[0032] Sequence structure: TGGCGCGCACCCACGGCCTG

[0033] 1.2 Blocker name: C32

[0034] Sequence structure: CTTCGCGTTAGCGTTGAGTG

[0035] 1.3 Blocker name: C35

[0036] Sequence structure: TTGCGCGCCCTCCATCGAGG

[0037] The above three CpG-ODN-like TLR9 blockers all have the structural features described in the invention, that is, they have a CGCG core structure at the 4th to 7th positions, but the flanking sequences are different, and all have similar blocking effects. Its preparation method is to chemically synthesize all thionucleotide fragments (entrusted to Shanghai Sangon Biological Co., Ltd. to synthesize), and the synthesis amount of each of the above blockers is 30OD.

Embodiment 2

[0038] Determination of the Effect of Example 2 CpG-ODN-like TLR9 Blocker on Cell Viability (MTT Method)

[0039] 2.1 Main materials, reagents and equipment:

[0040] 1) MTT reagent: Sigma, Inc. USA.

[0041] 2) DMEM culture fluid (1L / bag), Gibco, Inc.USA.

[0042] 3) Dimethyl sulfoxide, Chongqing Chuandong Chemical (Group) Co., Ltd.

[0043] 4) Microplate reader: Bio-RAD Model 550.

[0044] 5) Cell incubator: FORMA 3111.

[0045] 6) RAW264.7 cell line: ATCC, USA.

[0046] 7) (Healthy) human peripheral blood macrophages: provided by Southwest Hospital Blood Bank

[0047] 2.2 Experimental method: Using blue tetrazolium thiazolium (MTT) method, the mouse RAW264.7 cells and human peripheral blood macrophages were diluted to 1×10 with DMEM medium, respectively. 6 / mL, added to a 96-well plate (200 μL / well), placed at 37 ° C, 5% CO 2 After culturing in the incubator for 2 hours, the three blocking agents C41, C32, and C35 were respectively set up as experimental groups at di...

Embodiment 3

[0049] Example 3: Effects of CpG-ODN-like TLR9 blockers on the release of TNF-α from RAW264.7 cells and human peripheral blood macrophages induced by stimulating molecules

[0050]3.1 Main materials, reagents and equipment:

[0051] 1) DMEM culture medium (1L / bag), Gibco, Inc.USA.

[0052] 2) Human TNF-αELISA Kit, eBioscience, Inc.USA.

[0053] 3) Mouse TNF-αELISA Kit, eBioscience, Inc.USA.

[0054] 4) Microplate reader: Bio-RAD Model 550.

[0055] 5) Cell incubator: FORMA 3111.

[0056] 6) RAW264.7 cell line: ATCC, USA.

[0057] 7) (Healthy) human peripheral blood macrophages: provided by Southwest Hospital Blood Bank

[0058] 3.2 Experimental method: Dilute mouse RAW264.7 cells and human macrophages to 1×10 in DMEM medium 6 / mL, were added to 96-well plates (200 μL / well, each experimental group was 4 duplicate wells), at 37 ° C, 5% CO 2 After incubation for 2 h under the same conditions, after the cells adhered to the wall, the supernatant of the cells was replaced wi...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to a specific blocking agent of a Toll-like receptor 9 (TLR9). The blocking agent is a nonmethylated CpG nucleotide sequence segment, the core structure of which is a CGCG nucleotide sequence, and the length of the nonmethylated CpG nucleotide sequence segment is 12-30 nucleotides. The blocking agent can be specifically combined with the TLR9, can block the combination between other irritant aglucons and the TLR9 and inhibit the proinflammatory effect mediated by the receptor, and can be used for the adjuvant treatment of inflammatory resistance and allergy resistance and the preparation of an experiment reagent of immune inflammation.

Description

technical field [0001] The invention relates to an blocking agent, in particular to a Toll-like receptor 9 (TLR9) blocking agent and its application. Background technique [0002] Pathogenic microorganisms infect the human body usually cause systemic or local immune inflammatory response. In the past, it was generally believed that microbial proteins and lipopolysaccharides were the main sources of immune stimulation, but recent studies have found that the unique unmethylated CpG nucleotide sequence fragments (CpG-ODN) in microorganisms also have immunostimulatory effects, suggesting anti-inflammatory, Anti-allergic strategies are not limited to traditional methods, but need to consider the inflammatory effect caused by clearing unmethylated CpG-ODN. [0003] The inflammatory mechanism of unmethylated CpG-ODN is related to the TLR9 receptor (Toll like receptor 9) on many immune cells in mammals. TLR 9 receptor is a type I transmembrane protein, which can specifically recog...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C12N15/117A61K31/7088A61P29/00A61P37/08
Inventor 李彦郑江周红曹红卫王宁鲁永玲赵苛岑向阳
Owner THE FIRST AFFILIATED HOSPITAL OF THIRD MILITARY MEDICAL UNIVERSITY OF PLA
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com