Method for deleting exogenous gene in transgenic cell at fixed point

An exogenous gene and cell technology, applied in the field of genetic engineering, can solve the problems of increasing the difficulty of vector construction and cell screening steps, and achieve the effect of avoiding drug screening.

Active Publication Date: 2010-06-30
BEIJING GEFUCURE BIOTECHNOLOGY LIMITED COMPANY
View PDF0 Cites 8 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

This method needs to introduce a negative selection gene that interacts with FIAU when constructing an expression vector, and at the same time requires FIAU for drug screening, which undoubtedly increases the difficulty of vector construction and cell screening steps

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Method for deleting exogenous gene in transgenic cell at fixed point
  • Method for deleting exogenous gene in transgenic cell at fixed point
  • Method for deleting exogenous gene in transgenic cell at fixed point

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1c

[0023] The construction of embodiment 1cre recombinase eukaryotic expression vector

[0024] Using the PBS 185 plasmid as a template, PCR primers were designed to amplify the CDS sequence of cre recombinase, and at the same time, NheI and BsiWI restriction sites were introduced at both ends of the sequence.

[0025] The designed upstream and downstream primers are:

[0026] Nhe I-Cre-F:GAA GCTAGC ATGTCCAATTTACTGACCGTAC

[0027] Bsi WI-Cre-R:TCT CGTACG CTAATCGCCATCTTTCCAGCAG

[0028] The reaction system for Cre CDS amplification is: 50 μl reaction system, including 1 μl of PBS185 plasmid (200 ng / μl), 1 μl of each primer (20 pmol / μl), 6 μl of dNTP (10 mM), 5 μl of 5×LA PCR Buffer, LA Taq enzyme (Takara ) 0.3 μl.

[0029] The reaction program was: pre-denaturation at 94°C for 5 min, denaturation at 98°C for 10 s, annealing and extension at 68°C for 1 min, a total of 35 cycles, and 10 min at 72°C.

[0030] The PCR product was recovered and connected to the pMD19-T vector. ...

Embodiment 2

[0032] Example 2 Transfection of 293T cells and bovine fibroblasts and expression detection of cre recombinase

[0033] 2.1 Cell culture and transient transfection

[0034] Take bovine ear tissue and cut into 1mm 3 For the left and right small pieces, wash them twice with DMEM / F12 and then plant them in batches in a 25cm medium containing 1mL DMEM / F12+10%FBS. 2 In the culture flask, add DMEM / F12+10% FBS to 6mL after the tissue block is firmly adhered to the wall, and store at 37°C, 5% CO 2 Cultivate in an incubator for 6-7 days, change the medium once every 2 days, after the cells grow confluent, digest and passage with 0.25% trypsin for 2-3 times, freeze in batches with DMEM / F12+20%FBS+10%DMSO, and culture Bovine fibroblasts.

[0035] 293T cells and bovine fibroblasts were respectively inoculated in 6-well cell culture plates, and when they were cultured in DMEM medium containing 10% fetal bovine serum to 70-80% confluence, according to the instructions, Lipofectamine 2000...

Embodiment 3

[0038] Example 3 Screening and identification of gene deletion cells

[0039] 1LoxP-N n -Construction of the LoxP structure

[0040] The two ends of the Neo expression frame of the two LoxP site primers pIRES-NEO vector were constructed by primer amplification or restriction enzyme connection to form pIRES-LoxP-NEO-LoxP, and the two ends of the LoxP-NEO-LoxP structure can be introduced into special Restriction sites for connection to other specific expression vectors. The NEO gene in the LoxP-NEO-LoxP structure can also use any other gene structure (N n , N represents the nucleotide sequence, and n represents the number of nucleotides) to replace, that is, to construct LoxP-N n -LoxP structure.

[0041] 2 Cell culture and transient transfection

[0042] The above LoxP-N n -LoxP structure (take the LoxP-neo-LoxP structure as an example) to directly transfect bovine fibroblasts to obtain transgenic bovine fibroblasts that stably integrate the LoxP-neo-LoxP structure, and s...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides a method for deleting an exogenous gene in a transgenic cell at a fixed point. Expression vectors for expressing fluorescent protein and cre recombinase are constructed and are guided into a target cell to realize coexpression of the cre recombinase and the fluorescent protein. The cre recombinase deletes NnDNA sequence in a LoxP-Nn-Loxp structure at the fixed point. Through detecting the expression of the fluorescent protein in the cell, the cell that the gene is deleted at the fixed point is sorted. By adopting the method, the exogenous gene or marker gene is accurately deleted, the cell that the gene is deleted at the fixed point can be accurately sorted, the sorting by using drugs is avoided, and the method is of great significance to the cultivation of transgenic animals without marker genes, the further development of the research on the transgenic animals and the safety of transgenic animal foods.

Description

technical field [0001] The invention relates to the technical field of genetic engineering, in particular to a method for targeted deletion of exogenous genes in transgenic cells. Background technique [0002] Since the somatic cell cloned sheep "Dolly" was born in 1997, the production of transgenic livestock through somatic cell nuclear transfer technology has gradually become the main method of producing large transgenic animals by using somatic cells transfected with targeted genes as donors. At present, in the process of obtaining somatic cells transfected with a target gene, the commonly used method is to construct a eukaryotic resistance gene (also known as a marker gene, such as neomycin, etc.) Screening of marker genes to obtain somatic cells stably integrated with exogenous target genes. However, the existence of marker genes in transgenic animals has brought many inconveniences to the follow-up research of transgenic animals [1]. First, there are currently very l...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): C12N15/85G01N15/10C12Q1/68C12Q1/02
Inventor王少华丁方荣孙秀柱戴蕴平李宁
OwnerBEIJING GEFUCURE BIOTECHNOLOGY LIMITED COMPANY