A method for knocking out the mitochondrial gene of Toructus glabrata

A technology of T. glabrata and mitochondrial genes, which is applied in the field of microbial genetic engineering to achieve the effects of easy identification and protection, simple knockout method, and keeping the original characteristics unchanged.

Inactive Publication Date: 2011-12-21
JIANGNAN UNIV
View PDF0 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0003] At present, there are few institutions in China to study the molecular biology of Toructus glabrata, and it is still in the preliminary stage of research

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • A method for knocking out the mitochondrial gene of Toructus glabrata
  • A method for knocking out the mitochondrial gene of Toructus glabrata

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0024] Example 1 The method for knocking out the chromosomal gene ATP6 of Torulopsis glabrata

[0025] 1. Obtaining the pUC-atp6::ARG8m plasmid containing the target fragment

[0026] Use primer pairs:

[0027] Con-ATP6-F:

[0028] 5'GCggatccAATATTATTTTATTATAATAATAATTTAAATTTTAATAAGTTATAATATATATTTAAAGT ATGACACATTTAGAAAGAAG 3'

[0029] Con-ATP6-R:

[0030] 5'GCGggatccTATTAATAATAATTAATTAAAGAATATTATAATATAATTAATTTATTTGTATTATATAAA TTAAGCATATACAGCTTCG 3'

[0031] The knockout box Δatp6::ARG8m for knocking out ATP6 was amplified from the plasmid pDS24 containing the ARG8m gene. Starting from the 5' end of the primers, they are the protected bases of the restriction site (capital letters), the BamHI restriction site (lower case letters), the fragment homologous to ATP6 (capital letters) and the homology of ARG8m (underlined) sequence.

[0032] PCR conditions are: 95°C, 3min; {95°C, 50s; 55°C, 60s; 72°C, 1min}, 30 cycles; 72°C, 15min; -20°C storage. After the PCR product wa...

Embodiment 2

[0053] Example 2 The method for knocking out the chromosomal gene ATP8 of Torulopsis glabrata

[0054] 1. Obtaining the pUC-atp8::ARG8m plasmid containing the target fragment

[0055] Use primer pairs:

[0056] Con-ATP8-F:

[0057] 5'GCggatccATAATAATTTATTTATTTATTAATGTTGTATTTATATTAAATATAAAAAATATATAAAT ATGACACATTTAGAAAGAAG 3'

[0058] Con-ATP8-R:

[0059] 5'GCGggatccATAATTATATATTATTAATTATATTATATTATAATTATATATTATTATTATTAATTATAT TTAAGCATATACAGCTTCG 3'

[0060] The knockout box Δatp6::ARG8m for knocking out ATP6 was amplified from the plasmid pDS24 containing the ARG8m gene. Starting from the 5' end, the primers are the protected bases of the restriction site (capital letters), the BamHI restriction site (small letters), the fragment homologous to ATP8 (capital letters) and the homology of ARG8m (underlined). source sequence.

[0061] PCR conditions are: 95°C, 3min; {95°C, 50s; 55°C, 60s; 72°C, 1min}, 30 cycles; 72°C, 15min; -20°C storage. After the PCR product was dige...

Embodiment 3

[0082] Example 3 The method for knocking out the chromosomal gene ATP9 of Torulopsis glabrata

[0083] 1. Obtaining the pUC-atp9::ARG8m plasmid containing the target fragment

[0084] Use primer pairs:

[0085] Con-ATP9-F:

[0086] 5’GCggatccATATATATATATATATTAATTATTTAAATATAATAAAGATTATAAAAAATATAATATT ATGACACATTTAGAAAGAAG 3'

[0087] Con-ATP9-R:

[0088] 5'GCGggatccAAATATTTTATTTATTAAGAATATTATAATATTACTATATTAATAGTAAACATTATTATTA TTAAGCATATACAGCTTCG 3'

[0089] The knockout box Δatp9::ARG8m for knocking out ATP6 was amplified from the plasmid pDS24 containing the ARG8m gene. Starting from the 5' end of the primers, they are the protected bases of the restriction site (capital letters), the BamHI restriction site (small letters), the fragment homologous to ATP9 (capital letters) and the homology of ARG8m (underlined). source sequence.

[0090] PCR conditions are: 95°C, 3min; {95°C, 50s; 55°C, 60s; 72°C, 1min}, 30 cycles; 72°C, 15min; -20°C storage. After the PCR product ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a method for knocking out the mitochondrial gene of Toruula glabrata, belonging to the technical field of genetic engineering. The present invention mainly uses long-terminal primers to obtain a homologous recombination fragment containing the flanking sequence of the acetylornithine aminotransferase gene (ARG8m) and the mitochondrial gene to be knocked out, transforms yeast mitochondria with a biolistic gun, and eliminates mitochondrial heterogeneity by anaerobic culture Transformants containing only the engineered mitochondria were obtained. The yeast obtained in the present invention is easy to identify and protect; the knockout method provides a new approach and method for the genetic engineering of diploid or polyploid yeast; the knockout method is simple and efficient, and maintains the original characteristics of the yeast Unchanged, knockout of mitochondrial genes can be achieved within 5-7 days.

Description

technical field [0001] The invention belongs to the field of microbial genetic engineering, and in particular relates to a Togus glabrata glabrata with mitochondrial gene deletion and a knockout method thereof. Background technique [0002] Torulopsis glabrata is a haploid yeast without a sexual reproductive stage. Torulopsis glabrata is widely used for the production of pyruvate and α-ketoglutarate. Certain strains of Torulopsis glabrata are clinically opportunistic pathogens. The genetic engineering research of Torulopsis glabrata is still in its infancy. The most commonly used genetic markers in yeast are auxotrophic markers that can accomplish complementation. [0003] At present, there are few institutions in China to study the molecular biology of Toructus glabrata, and it is still in the preliminary stage of research. Screening the auxotrophic strains of Torulopsis glabrata is one of the important basic tasks for in-depth research on it. Contents of the inventio...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityPatents(China)
IPC IPC(8): C12N15/54C12N15/63C12N1/19C12R1/645
Inventor刘立明周景文陈坚堵国成
OwnerJIANGNAN UNIV