Unlock instant, AI-driven research and patent intelligence for your innovation.

Fast detection method of nucleic acid of A H1N1 influenza virus and kit thereof

An influenza virus and kit technology, applied in biochemical equipment and methods, microbial determination/inspection, fluorescence/phosphorescence, etc., can solve the problems of sample contamination, high false positive rate, erroneous results, etc. Simple and convenient operation

Inactive Publication Date: 2012-11-14
JIANGSU PROVINCIAL CENT FOR DISEASE PREVENTION & CONTROL
View PDF0 Cites 2 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

This method has high detection sensitivity and simple operation, but has the disadvantages of sample contamination, high false positive rate, etc., resulting in wrong results

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Fast detection method of nucleic acid of A H1N1 influenza virus and kit thereof
  • Fast detection method of nucleic acid of A H1N1 influenza virus and kit thereof
  • Fast detection method of nucleic acid of A H1N1 influenza virus and kit thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0023] A method for rapid detection of nucleic acid of influenza A H1N1 virus at constant temperature, the steps are as follows:

[0024] a. Prepare specific detection primers, use bioinformatics knowledge and related bioinformatics software to compare all the nucleic acid sequences of influenza A H1N1 influenza hemagglutinin (HA) gene that can be retrieved in the existing nucleic acid database. Design primers with conservative sequences, and add T7 promoter sequence (underlined part) to the 5'end of the reverse primer to obtain specific detection primers, as shown below:

[0025] Forward SW HA P2

[0026] 5’-ATTCACCATCCATCTACTAG-3’

[0027] Reverse SW H1 P1

[0028] 5’- AATTCTAATACGACTCACTATAGGG GTCCAGTAATAGTTCATTCTC-3’,

[0029] All primers are synthesized by Shanghai Shenggong Biological Engineering Technology Service Co., Ltd.;

[0030] b. Design specific detection probes, use bioinformatics knowledge and related biology

[0031] Informatics software designs molecular beacon probes i...

Embodiment 2

[0045] The method of the present invention is used to prepare a detection kit for constant temperature real-time rapid detection of influenza A H1N1 influenza virus nucleic acid. The preparation method is the same as that of conventional preparation kits, which will not be repeated here. The difference is: Including 11ul constant temperature amplification reaction solution containing primer probe and 7ul enzyme mixture composed of AMV reverse transcriptase, T7 RNA polymerase and nuclease H. The amplification reaction solution contains 40mM tris-hydrochloric acid (pH 8.5), 12mM magnesium chloride, 70mM potassium chloride, 5mM dithiothreitol 1, 1mM deoxynucleotide triphosphate (dATP, dCTP, dGTP, dTTP), 0.5-2mM nucleotide triphosphates (ATP, CTP, UTP, GTP, ITP), 15% (vol / vol) dimethyl sulfoxide, 0.6μM specific detection primer, 0.2μM specific detection probe needle. The enzyme mixture is 0.1U nuclease H, 40U T7 RNA polymerase and 8U of AMV reverse transcriptase. The test results...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to a fast detection method of nucleic acid of A H1N1 influenza virus, and a kit thereof, belonging to the technical field biotechnology. The invention provides a fast and synthermal RNA amplification method of A H1N1 influenza virus, and the accomplishment of the entire reaction depends on the cooperation of the AMV reverse transcriptase, the T7RNA polymerase and nuclease H (RNaseH), without the needs of the special instruments and the temperature cycling, the amplification efficiency is larger than or equal to that of the PCR, and the reaction product is single stranded RNA. The invention has the advantages of having equal or higher sensibility than that of the RT-PCR detection method, avoiding the pollution problem of the RT-PCR amplification product due to that the amplification product is RNA, finishing the reaction in one hour, and simple and convenient operation. The reaction can be monitored in real time and detected by the end-point method, can be used as the important tool in the detection of A H1N1 influenza virus.

Description

Technical field [0001] The invention relates to a method and a kit for detecting viral nucleic acid, belonging to the field of biotechnology. Background technique [0002] An outbreak of "human swine flu" occurred in Mexico in March 2009, causing deaths. On June 11, the World Health Organization (hereinafter referred to as WHO) announced that it would raise the pandemic warning level to the highest level 6, which means that a new round of influenza pandemic is coming. Studies have found that the pathogen of this epidemic is a mutated new type A H1N1 influenza virus. This strain contains gene fragments of three influenza viruses: swine flu, avian flu and human flu, which can be transmitted from person to person. The WHO initially referred to this flu epidemic as "human infection with swine flu", but with in-depth understanding of the nature of the epidemic, it has now been renamed as "H1N1 influenza." The Ministry of Health of my country announced on April 30 that it will be inc...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C12Q1/70C12Q1/68G01N21/64
Inventor 崔仑标葛以跃史智扬祁贤郭喜玲赵康辰单军单云峰戚宇华汪华
Owner JIANGSU PROVINCIAL CENT FOR DISEASE PREVENTION & CONTROL
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More