Fast detection method of nucleic acid of A H1N1 influenza virus and kit thereof
An influenza virus and kit technology, applied in biochemical equipment and methods, microbial determination/inspection, fluorescence/phosphorescence, etc., can solve the problems of sample contamination, high false positive rate, erroneous results, etc. Simple and convenient operation
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0023] A method for rapid detection of nucleic acid of influenza A H1N1 virus at constant temperature, the steps are as follows:
[0024] a. Prepare specific detection primers, use bioinformatics knowledge and related bioinformatics software to compare all the nucleic acid sequences of influenza A H1N1 influenza hemagglutinin (HA) gene that can be retrieved in the existing nucleic acid database. Design primers with conservative sequences, and add T7 promoter sequence (underlined part) to the 5'end of the reverse primer to obtain specific detection primers, as shown below:
[0025] Forward SW HA P2
[0026] 5’-ATTCACCATCCATCTACTAG-3’
[0027] Reverse SW H1 P1
[0028] 5’- AATTCTAATACGACTCACTATAGGG GTCCAGTAATAGTTCATTCTC-3’,
[0029] All primers are synthesized by Shanghai Shenggong Biological Engineering Technology Service Co., Ltd.;
[0030] b. Design specific detection probes, use bioinformatics knowledge and related biology
[0031] Informatics software designs molecular beacon probes i...
Embodiment 2
[0045] The method of the present invention is used to prepare a detection kit for constant temperature real-time rapid detection of influenza A H1N1 influenza virus nucleic acid. The preparation method is the same as that of conventional preparation kits, which will not be repeated here. The difference is: Including 11ul constant temperature amplification reaction solution containing primer probe and 7ul enzyme mixture composed of AMV reverse transcriptase, T7 RNA polymerase and nuclease H. The amplification reaction solution contains 40mM tris-hydrochloric acid (pH 8.5), 12mM magnesium chloride, 70mM potassium chloride, 5mM dithiothreitol 1, 1mM deoxynucleotide triphosphate (dATP, dCTP, dGTP, dTTP), 0.5-2mM nucleotide triphosphates (ATP, CTP, UTP, GTP, ITP), 15% (vol / vol) dimethyl sulfoxide, 0.6μM specific detection primer, 0.2μM specific detection probe needle. The enzyme mixture is 0.1U nuclease H, 40U T7 RNA polymerase and 8U of AMV reverse transcriptase. The test results...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More - R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com
