Monocotyledon promoter, preparation method and application thereof

A monocot and promoter technology, applied in the field of promoters, can solve problems such as limited regulatory effects

Inactive Publication Date: 2010-11-24
KUNMING INST OF ZOOLOGY CHINESE ACAD OF SCI
View PDF0 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

The Adh-1 promoter is mainly used in monocotyledonous plants, but it has very limited effect on the regulation of gene expression in most dicotyledonous plants

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Monocotyledon promoter, preparation method and application thereof
  • Monocotyledon promoter, preparation method and application thereof
  • Monocotyledon promoter, preparation method and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment

[0055] A, PCR amplification of the monocot promoter fragment:

[0056] Using a novel plant genomic DNA extraction kit (TIANGEN catalog number: DP320-02), according to the sequence of the promoter in the gDNA of the cultivated rice Nipponbare variety, design a pair of PCR-specific amplification primers at the beginning and end respectively, namely:

[0057] Upstream primer F1:CG GGATCC AGTTCGCAAGCAAACGGCACGG, where the underlined part represents the restriction site of BamH1;

[0058] Downstream primer R1: AAGCTT GCAGACGACGAGAG, where the underline represents the HindIII restriction site;

[0059] Using self-extracted gDNA of rice Nipponbare variety as template, high-fidelity Ex Taq TM (TaKaRa, DRR100B) polymerase for PCR amplification, wherein:

[0060] The amplified PCR system is shown in Table 2;

[0061] Table 2 PCR system for gene promoter amplification

[0062]

[0063] The PCR amplification program is: pre-denaturation at 94°C for 5 minutes, then denaturation a...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

No PUM Login to view more

Abstract

The invention provides a monocotyledon promoter, a preparation method and application thereof. The nucleotide sequence of the promoter is shown as the sequence 1 in the sequence table. The promoter can be used for regulating and controlling the expressions of target genes in monocotyledons, particularly the expressions of GUS (Glucuronidase) genes in rice and can be also used for regulating and controlling efficiently expressed exogenous genes with special properties of plants and is of great importance to the research on the molecular breeding of superior rice.

Description

technical field [0001] The present invention relates to a promoter, especially a monocotyledonous plant promoter, as well as the preparation method and application of the promoter. Background technique [0002] The promoter is a part of the gene, usually located upstream of the 5' end of the structural gene, and is a DNA sequence that RNA polymerase recognizes, binds and initiates transcription. The promoter can guide the holoenzyme to correctly combine with the template, activate RNA polymerase, and initiate gene transcription, thereby controlling the initiation time and degree of gene expression (transcription). In transgenic plants, the promoter is one of the important factors affecting the expression efficiency of the transgene, and the selection of a high-efficiency promoter is the key to high-efficiency expression of foreign genes. [0003] Promoters can be divided into three categories according to their transcriptional patterns: constitutive promoters, tissue or org...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
Patent Type & Authority Applications(China)
IPC IPC(8): C12N15/113C12N15/63C12N1/21C12N15/10A01H5/00
Inventor 王文董杨徐讯
Owner KUNMING INST OF ZOOLOGY CHINESE ACAD OF SCI
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap