Wheat spikelet number QTL linked SNP molecular marker and application thereof
A technology of molecular markers and spikelet number, which is applied in the field of molecular biology and crop genetics and breeding, can solve the problems of insufficient molecular markers, achieve accurate and efficient detection, convenient and stable amplification, and improve the efficiency of breeding work
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0038] Example 1 Acquisition of wheat spikelet number QTL QSns.sau-2D.1 and its molecular marker KASP-1
[0039] (1) Using the wheat line '20828' as the female parent and the wheat variety 'CN16' as the male parent, the hybrid F 1 , F 1 F 2 , at F 2 Using the single-ear transmission method, all the way to F 8 Generations, recombinant inbred lines containing 199 lines were obtained to form a genetic mapping population.
[0040] (2) Phenotypic identification of the number of spikelets in the recombinant inbred line population: analyze and identify the number of spikelets in the recombinant inbred line during the wheat maturity stage, remove the individual plants at both ends of each row, collect five individual plants with the same growth, and select Main panicle, calculate the number of spikelets, and get the average value, which represents the number of spikelets of the line.
[0041] (3) 55K SNP chip analysis
[0042] a) DNA extraction: DNA of parent '20828', 'CN16' and...
Embodiment 2
[0050] Example 2 Application of Molecular Marker KASP-1 in Selection and Control of Spike Number QTL QSns.sau-2D.1
[0051] (1) Using the common wheat line '20828' with a large number of spikelets as the female parent and the common wheat line 'SY95-71' with a small number of spikelets as the male parent to construct recombinant inbred lines, randomly select 80 offspring lines strain.
[0052] (2) Carry out KASP-1 marker detection on the obtained 80 strains, the specific method is: extract the DNA of 80 strains; use it as a template, and carry out PCR with the specific primer pair of molecular marker KASP-1 as primers To amplify and perform a fluorescent readout, the primers are:
[0053] Primers on the FAM tag: (the underlined part is the FAM tag sequence)
[0054] 5'- GAAGGTGACCAAGTTCATGCT TATAAACCGGTCGAACTCGC-3' (SEQ ID No. 1)
[0055] Primers on the HEX tag: (the wavy part is the HEX tag sequence)
[0056] 5'- GAAGGTCGGAGTCAACGGATT TATAAACCGGTCGAACTCGT-3' (SEQ ID N...
PUM

Abstract
Description
Claims
Application Information

- R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com