Unlock instant, AI-driven research and patent intelligence for your innovation.

Wheat spikelet number QTL linked SNP molecular marker and application thereof

A technology of molecular markers and spikelet number, which is applied in the field of molecular biology and crop genetics and breeding, can solve the problems of insufficient molecular markers, achieve accurate and efficient detection, convenient and stable amplification, and improve the efficiency of breeding work

Active Publication Date: 2019-05-31
SICHUAN AGRI UNIV
View PDF1 Cites 16 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0006] Previously, some scholars conducted QTL mapping for spikelet number and found that related QTLs widely exist in wheat. However, there are not many closely linked molecular markers related to wheat spikelet number traits that can be used for practical molecular breeding.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Wheat spikelet number QTL linked SNP molecular marker and application thereof
  • Wheat spikelet number QTL linked SNP molecular marker and application thereof
  • Wheat spikelet number QTL linked SNP molecular marker and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0038] Example 1 Acquisition of wheat spikelet number QTL QSns.sau-2D.1 and its molecular marker KASP-1

[0039] (1) Using the wheat line '20828' as the female parent and the wheat variety 'CN16' as the male parent, the hybrid F 1 , F 1 F 2 , at F 2 Using the single-ear transmission method, all the way to F 8 Generations, recombinant inbred lines containing 199 lines were obtained to form a genetic mapping population.

[0040] (2) Phenotypic identification of the number of spikelets in the recombinant inbred line population: analyze and identify the number of spikelets in the recombinant inbred line during the wheat maturity stage, remove the individual plants at both ends of each row, collect five individual plants with the same growth, and select Main panicle, calculate the number of spikelets, and get the average value, which represents the number of spikelets of the line.

[0041] (3) 55K SNP chip analysis

[0042] a) DNA extraction: DNA of parent '20828', 'CN16' and...

Embodiment 2

[0050] Example 2 Application of Molecular Marker KASP-1 in Selection and Control of Spike Number QTL QSns.sau-2D.1

[0051] (1) Using the common wheat line '20828' with a large number of spikelets as the female parent and the common wheat line 'SY95-71' with a small number of spikelets as the male parent to construct recombinant inbred lines, randomly select 80 offspring lines strain.

[0052] (2) Carry out KASP-1 marker detection on the obtained 80 strains, the specific method is: extract the DNA of 80 strains; use it as a template, and carry out PCR with the specific primer pair of molecular marker KASP-1 as primers To amplify and perform a fluorescent readout, the primers are:

[0053] Primers on the FAM tag: (the underlined part is the FAM tag sequence)

[0054] 5'- GAAGGTGACCAAGTTCATGCT TATAAACCGGTCGAACTCGC-3' (SEQ ID No. 1)

[0055] Primers on the HEX tag: (the wavy part is the HEX tag sequence)

[0056] 5'- GAAGGTCGGAGTCAACGGATT TATAAACCGGTCGAACTCGT-3' (SEQ ID N...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a wheat spikelet number QTL linked SNP molecular marker and application thereof. The SNP molecular marker KASP-1 is located on the short arm of a 2D chromosome of the RefSeqv1.0 genome version, and the 100 bp sequence before and after is shown as SEQ ID NO.46, the polymorphism is C / T and can be obtained by primer amplification shown in SEQ ID NO.1-3. The molecular marker can accurately track the wheat spikelet number QTL QSns.sau-2D.1 to predict the wheat spikelet number and facilitate molecular breeding. The invention also discloses a method for identifying the wheat spikelet number QTL QSns.sau-2D.1 molecular marker. By means of the method, the wheat spikelet number prediction accuracy can be enhanced, so as to quickly screen out wheat varieties or lines with increased spikelet number for breeding, and the breeding process of the wheat high yield varieties can be accelerated.

Description

technical field [0001] The invention relates to the fields of molecular biology and crop genetic breeding, in particular to a SNP molecular marker linked to wheat spikelet number QTLQSns.sau-2D.1 and its application. Background technique [0002] Wheat is one of the most important food crops in the world, and it is also an important food crop in my country. Its perennial planting area is more than 20 million hectares, accounting for about 27% of all food crops; the total output exceeds 100 million tons, accounting for about 22% of all food crop production. Wheat yield depends on grain weight, number of grains per panicle and number of panicles per unit area. The number of grains per spike is the most active factor among the yield components, and it can be adjusted to a large extent. The number of grains per spike is determined by the number of spikelets, the number of differentiated florets, and the seed setting rate of florets. The number of spikelets is the prerequisite f...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12Q1/6895C12Q1/686C12N15/11
Inventor 马建兰秀锦丁浦洋郑有良魏育明江千涛陈国跃刘亚西李伟
Owner SICHUAN AGRI UNIV
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More