Method and kit for detecting gene mutation of human cytochrome P450 CYP2C19

A P450CYP2C19, cytochrome technology, applied in the field of molecular biology, can solve problems such as increased blood drug concentration, failure to reach effective blood drug concentration, and drug side effects

Inactive Publication Date: 2011-08-03
BEIJING ADINOVO TECH
View PDF2 Cites 13 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, EM patients are strongly induced by PHT enzyme activity, and the blood drug concentration after steady state is about 3 / 5 of that of VPA normal metabolizers alone, so that when VPA is combined with PHT, the blood drug concentration of EM patients is significantly lower than that of PM patients. Those who can not reach the effective blood concentration
On the contrary, when taking the same dose of VPA, the blood concentration of PM phenotype patients is abnormally increased, and drug side effects are prone to occur.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Method and kit for detecting gene mutation of human cytochrome P450 CYP2C19
  • Method and kit for detecting gene mutation of human cytochrome P450 CYP2C19
  • Method and kit for detecting gene mutation of human cytochrome P450 CYP2C19

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0045] Embodiment 1: Detection kit of human cytochrome P450CYP2C19 gene mutation according to the present invention

[0046] The CYP2C19 genotyping kit of the present invention includes four units of PCR amplification reaction, amplification product purification, sequencing reaction, homozygous sequencing product and sample loading.

[0047] PCR Amplification Reaction Unit

[0048] The PCR amplification unit for detecting M1 and M2 contains one tube of reaction reagent and one tube of positive reference substance.

[0049] 1. PCR reaction reagent

[0050] It is prepared by specific primer pair, PCR buffer, dNTP mixture and Taq DNA polymerase according to the optimized reaction concentration.

[0051] 1) Specific primers: 50-100 nmol / L each for the forward and reverse primers.

[0052] Oligo6 software was used to design specific PCR primers for amplifying gene fragments containing M1 or M2 mutation sites, and the sequences were:

[0053] The forward primer (M1-F) for detect...

Embodiment 2

[0100] Embodiment 2: Apply the method and kit of the present invention to carry out CYP2C19 mutation detection equipment:

[0101] PCR amplification instrument, ABI 3130 genetic analyzer, ultra-clean workbench, high-speed desktop centrifuge, water bath, electrophoresis apparatus, etc.

[0102] Extract genomic DNA:

[0103] Sodium citrate or sodium citrate anticoagulant peripheral venous blood 100μl, add 2-5 times the volume of human erythrocyte lysate, mix well, ice bath for 10-15 minutes, centrifuge at 2000rmp for 5 minutes, discard the supernatant to collect lymphocytes, and use whole Blood Genomic DNA Extraction Kit to extract genomic DNA. Various methods can be used to extract whole blood genomic DNA, such as alkaline lysis, silica gel, silica adsorption, magnetic bead adsorption, chromatography column, etc. Currently, there are many commercial kits to choose from, and column layer is recommended Analysis kit.

[0104] PCR reaction

[0105] 1) Take out the PCR reaction...

Embodiment 3

[0138] Example 3: Performing Genotype Analysis

[0139] Based on biological information analysis of sequencing sequences and mutation sites, determine the sequence characteristics of M1 and M2 wild-type and mutant alleles:

[0140] Amplify and analyze according to the method described in Example 1 and Example 2. Taking the detection of M1 mutation as an example, the bioinformatics analysis is described as follows:

[0141] The expected sequence of the forward sequencing of the amplified product of the detection M1 mutation primer is:

[0142] AAAGCAGGTATAAGTCTAGGAAATGATTATCATCTTTGATTCTCTTGTCAGAATTTTCTTTCTCAAATCTTGTATAATCAGAGAATTACTACACATGTACAATAAAAATTTCCCATCAAGATATACAATATATTTTTTATATTTAGTTTTAAATTACAACCAGAGCTTGGCATATTGTATCTTAACTTTATTATTAAATGCTTTTAATTTTAATAAATTATTGTTTTTCTTAGATTTACTTCG GGAACCCATAACAAATTACTTAAAAACCTTGCTTTTATGGAAAGTGATATTTTGGAGAAAGTAAAAGAACACCAAGAATCGATGGACATCAACAACCCTCGGGACTTTATTGATTGCTTCCTGATCAAAATGGAGAAGGTAAAATGTTAACAAAAGCTTAGTTATGTGACTGCTTGCGTATTTGTG (the nucl...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to the field of molecular biology, and discloses a method for detecting gene mutation of human cytochrome P450 CYP2C19, which comprises the following steps of: performing amplification on a sample genome by using primers, wherein the primers comprise upstream and downstream primers for detecting M1 mutation, and upstream and downstream primers for detecting M2 mutation, the nucleotides of the upstream and downstream primers for detecting M1 mutation are shown as SEQ ID No.1 and SEQ ID No.2, and the nucleotides of the upstream and downstream primers for detecting M2 mutation are shown as SEQ ID No.5 and SEQ ID No.6; and setting a reference for quality control, and sequencing an amplification product by using sequencing primers of which the nucleotides are shown as SEQ ID No.9 and SEQ ID No.10. The invention also provides a kit for detecting gene mutation of human cytochrome P450 CYP2C19. According to detection results of the method, guidance and adjustment of clinical medication schemes are carried out, a basis is provided for clinical individualized medication, the treatment effect can be improved and the toxic and side effect risks can be reduced.

Description

technical field [0001] The invention relates to the field of molecular biology, in particular to a method and a kit for detecting human cytochrome P450CYP2C19 gene mutation. Background technique [0002] The cytochrome P450CYP2C19 gene encodes S-mephenytoin hydroxylase, which mainly exists in human liver cells, catalyzes phase I metabolic reactions such as hydroxylation, oxidation, and cyclization, and participates in the metabolism of various drugs. There are genetic differences in CYP2C19 enzyme activity in the population. Using mephenytoin or similar substrates as phenotypic probes, CYP2C19 can be divided into different phenotypes: those with fast hydroxylation reaction speed are strong metabolic phenotypes (Extensive Metabolism, EM ), those with slow hydroxylation reaction rate are poor metabolizers (Poor Metabolism, PM). The incidence of PM in Caucasians is low (1-2%), while the frequency of PM phenotypes is higher in Asian populations, the incidence of PM in Chinese H...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12Q1/68
Inventor白玉杰
OwnerBEIJING ADINOVO TECH