Gene GE1 for controlling size of paddy embryo and use thereof
A technology of size control and genetics, applied in genetic engineering, plant genetic improvement, application, etc., can solve problems such as limiting the improvement of rice nutritional components
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0045] Embodiment 1, the cloning of rice embryo size control gene GE1:
[0046] 1. Rice material
[0047] Rice (Oryza sativa ssp.) giant embryo mutant ge1 (i.e., japonica mutant material (Japonica) "ge1", also known as japonica rice mutant ge1) and phenotypically normal indica rice variety (Indica) "Taichung Local No. 1 ( TN1)".
[0048] 2. Analyze and target groups
[0049] The homozygous indica variety TN1 was crossed with the japonica mutant ge1, and F 1 A total of 5,940 F 2 Individual, carry out phenotypic identification to the F2 generation seed, the positive and negative control performance of phenotype: show as positive with common rice grain, show as negative with giant embryo rice grain (respectively as figure 1 A, B shown).
[0050] 1,280 individuals with giant embryos were selected as the positioning group. At the seedling stage, about 0.1 grams of young leaves were taken from each plant to extract DNA.
[0051] 3. Localization of GE1 gene by SSR and STS marker...
Embodiment 2
[0068] Example 2 Functional Complementation and Transgenic Research of Rice Embryo Size Gene GE1
[0069] Primers were designed according to the sequence of Nipponbare GE1 gene in normal embryos, and were amplified by high-fidelity PCR with primers GE-1F and GE-1R.
[0070] GE-1F: TTACGGTTGACAGAGGATTACAT
[0071] GE-1R: AACTTGACAAAACAAAACAGATT
[0072] The PCR reaction system is: 1 μl DNA solution (Nipponbare DNA of normal embryos), 10×PCR Buffer 2.0ul, 25mM MgCl 2 2.0ul, 2mM dNTP 5.0ul, 10uM primer 2.0ul, 5U / ul Taq DNA polymerase 0.5ul, ddH 2 O7.5ul, total system 20ul. Reaction program: pre-denaturation at 94°C for 5min, 1min at 94°C, 1min at 58°C, 4min at 72°C, 35cycles, extension at 72°C for 10mins.
[0073] And use the ABI3730DNA analyzers type sequencer sequencing (ABI company), select the completely correct clones of the sequence and utilize the common EcoR I and Xba I sites to connect them into a 3,602bp fragment, including 1,166 bases upstream of the initiation co...
Embodiment 3
[0075] Embodiment 3, the acquisition of giant embryo rice
[0076] Primers were designed according to the sequence of the Nipponbare GE1 gene of the normal embryo, and high-fidelity PCR was performed using primers GEi-1F and GEi-1R (see Appendix 1 for the sequence).
[0077] GEi-1F: gaggtacccctccgactagtccttcacg
[0078] GEi-1R: agggatcctgtcgggagtctgagctcttc;
[0079] The PCR reaction system is: 1 μl DNA solution (Nipponbare DNA of normal embryos), 10×PCR Buffer 2.0ul, 25mM MgCl 2 2.0ul, 2mM dNTP 5.0ul, 10uM primer 2.0ul, 5U / ul Taq DNA polymerase 0.5ul, ddH 2 O6.5ul, total system 20ul. Pre-denaturation at 94°C for 5min, 94°C for 1min, 55°C for 1min, 72°C for 1min, 35cycles, 72°C for 10mins, and sequenced with ABI3730 DNA analyzers (ABI company), to select clones with completely correct sequences using shared SpeI, SacI, BamHI and KpnI site to connect them into a 384bp fragment (as shown in SEQID NO: 3), cloned in the binary vector pTCK303 (purchased from CAMIA company), obt...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More