Conditionally replicating oncolytic adenoviral vector used for expressing two exogenous genes and modified by small peptide, construction method and application thereof
An oncolytic adenovirus and exogenous gene technology, applied in the field of conditionally replicable oncolytic adenoviral vectors and their construction, can solve the problems of host cells not being able to enter the cell division cycle, low infection efficiency of tumor tissue, limited number of expressed therapeutic genes, etc. question
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0042] The conditionally replicable oncolytic adenovirus HE1B55D-RGD.IL-24 / Arresten vector in this example is as follows:
[0043] 1. There is a 1083bp deletion between 2245bp-3327b of the human adenovirus type 5 genome, and the deleted sequence is as follows:
[0044] ATGTTGTACAGGTGGCTGAACTGTATCCAGAACTGAGACGCATTTTGACAATTACAGAGGATGGGCAGGGGCTAAAGGGGG
[0045] TAAAGAGGGAGCGGGGGGCTTGTGAGGCTACAGAGGAGGCTAGGAATCTAGCTTTTAGCTTAATGACCAGACACCGTCCTG
[0046] AGTGTATTACTTTTCAACAGATCAAGGATAATTGCGCTAATGAGCTTGATCTGCTGGCGCAGAAGTATTCCATAGAGCAGC
[0047] TGACCACTTACTGGCTGCAGCCAGGGGATGATTTTGAGGAGGCTATTAGGGTATATGCAAAGGTGGCACTTAGGCCAGATT
[0048] GCAAGTACAAGATCAGCAAACTTGTAAATATCAGGAATTGTTGCTACATTTCTGGGAACGGGGCCGAGGTGGAGATAGATA
[0049] CGGAGGATAGGGTGGCCTTTAGATGTAGCATGATAAATATGTGGCCGGGGGTGCTTGGCATGGACGGGGTGGTTATTATGA
[0050] ATGTAAGGTTTACTGGCCCCAATTTTAGCGGTACGGTTTTCCTGGCCAATACCAACCTTATCCTACACGGTGTAAGCTTCT
[0051] ATGGGTTTAACAATACCTGTGTGGAAGCCTGGACCGATGTAAGGGTTCGGGGCTGTGCCTTTTACTGCTGCTGGAAGGG...
Embodiment 2
[0131] The conditionally replicable oncolytic adenovirus HE1B55D-RGD.IL-24 / Trail vector in this example is as follows:
[0132] In Example 1, the first exogenous gene of Arresten inserted into an expression element expressing Arresten between 2245bp and 3327bp of the adenovirus genome was replaced with Trail. Other structures are the same as in Example 1, constituting a conditionally replicable oncolytic adenovirus HE1B55D-RGD.IL-24 / Trail vector.
[0133] Its construction method is the same as in Example 1.
Embodiment 3
[0135] The vector of conditionally replicable oncolytic adenovirus HE1B55D-RGD.IL-24 / Endostat in this example is as follows:
[0136] In Example 1, the first exogenous gene of Arresten inserted into an expression element expressing Arresten between 2245bp and 3327bp of the adenovirus genome was replaced with Endostatin. Other structures are the same as in Example 1, constituting a conditionally replicable oncolytic adenovirus HE1B55D-RGD.IL-24 / Endostat in vector.
[0137] Its construction method is the same as in Example 1.
PUM

Abstract
Description
Claims
Application Information

- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com