Conditionally replicating oncolytic adenoviral vector used for expressing two exogenous genes and modified by small peptide, construction method and application thereof
An oncolytic adenovirus and exogenous gene technology, applied in the field of conditionally replicating oncolytic adenovirus vector and its construction, can solve the problem that the therapeutic effect is not very obvious, the host cell cannot enter the cell division cycle, and the number of expressed therapeutic genes is limited, etc. question
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0042] The conditionally replicable oncolytic adenovirus HE1B55D-RGD.IL-24 / Arresten vector in this example is as follows:
[0043] 1. There is a 1083bp deletion between 2245bp-3327b of the human adenovirus type 5 genome, and the deleted sequence is as follows:
[0044] ATGTTGTACAGGTGGCTGAACTGTATCCAGAACTGAGACGCATTTTGACAATTACAGAGGATGGGCAGGGGCTAAAGGGGG
[0045] TAAAGAGGGAGCGGGGGGCTTGTGAGGCTACAGAGGAGGCTAGGAATCTAGCTTTTAGCTTAATGACCAGACACCGTCCTG
[0046] AGTGTATTACTTTTCAACAGATCAAGGATAATTGCGCTAATGAGCTTGATCTGCTGGCGCAGAAGTATTCCATAGAGCAGC
[0047] TGACCACTTACTGGCTGCAGCCAGGGGATGATTTTGAGGAGGCTATTAGGGTATATGCAAAGGTGGCACTTAGGCCAGATT
[0048] GCAAGTACAAGATCAGCAAACTTGTAAATATCAGGAATTGTTGCTACATTTCTGGGAACGGGGCCGAGGTGGAGATAGATA
[0049] CGGAGGATAGGGTGGCCTTTAGATGTAGCATGATAAATATGTGGCCGGGGGTGCTTGGCATGGACGGGGTGGTTATTATGA
[0050] ATGTAAGGTTTACTGGCCCCAATTTTAGCGGTACGGTTTTCCTGGCCAATACCAACCTTATCCTACACGGTGTAAGCTTCT
[0051] ATGGGTTTAACAATACCTGTGTGGAAGCCTGGACCGATGTAAGGGTTCGGGGCTGTGCCTTTTACTGCTGCTGGAAGGG...
Embodiment 2
[0131] The conditionally replicable oncolytic adenovirus HE1B55D-RGD.IL-24 / Trail vector in this example is as follows:
[0132] In Example 1, the first exogenous gene of Arresten inserted into an expression element expressing Arresten between 2245bp and 3327bp of the adenovirus genome was replaced with Trail. Other structures are the same as in Example 1, constituting a conditionally replicable oncolytic adenovirus HE1B55D-RGD.IL-24 / Trail vector.
[0133] Its construction method is the same as in Example 1.
Embodiment 3
[0135] The vector of conditionally replicable oncolytic adenovirus HE1B55D-RGD.IL-24 / Endostat in this example is as follows:
[0136] In Example 1, the first exogenous gene of Arresten inserted into an expression element expressing Arresten between 2245bp and 3327bp of the adenovirus genome was replaced with Endostatin. Other structures are the same as in Example 1, constituting a conditionally replicable oncolytic adenovirus HE1B55D-RGD.IL-24 / Endostat in vector.
[0137] Its construction method is the same as in Example 1.
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 