Conditionally replicating oncolytic adenoviral vector used for expressing two exogenous genes and modified by small peptide, construction method and application thereof

An oncolytic adenovirus and exogenous gene technology, applied in the field of conditionally replicating oncolytic adenovirus vector and its construction, can solve the problem that the therapeutic effect is not very obvious, the host cell cannot enter the cell division cycle, and the number of expressed therapeutic genes is limited, etc. question

Active Publication Date: 2014-03-12
SHAANXI NORMAL UNIV
View PDF3 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

CRAd5-D24 cannot bind Rb to inactivate it, resulting in the inability of host cells to enter the cell division cycle, so CRAd5-D24 can only replicate in tumor cells with abnormal Rb to produce killing effect
However, due to some shortcomings of this type of viral vector itself, such as low infection efficiency of tumor tissue and limited number of expressed therapeutic genes, etc., the therapeutic effect is not very obvious

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Conditionally replicating oncolytic adenoviral vector used for expressing two exogenous genes and modified by small peptide, construction method and application thereof
  • Conditionally replicating oncolytic adenoviral vector used for expressing two exogenous genes and modified by small peptide, construction method and application thereof
  • Conditionally replicating oncolytic adenoviral vector used for expressing two exogenous genes and modified by small peptide, construction method and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0042] The conditionally replicable oncolytic adenovirus HE1B55D-RGD.IL-24 / Arresten vector in this example is as follows:

[0043] 1. There is a 1083bp deletion between 2245bp-3327b of the human adenovirus type 5 genome, and the deleted sequence is as follows:

[0044] ATGTTGTACAGGTGGCTGAACTGTATCCAGAACTGAGACGCATTTTGACAATTACAGAGGATGGGCAGGGGCTAAAGGGGG

[0045] TAAAGAGGGAGCGGGGGGCTTGTGAGGCTACAGAGGAGGCTAGGAATCTAGCTTTTAGCTTAATGACCAGACACCGTCCTG

[0046] AGTGTATTACTTTTCAACAGATCAAGGATAATTGCGCTAATGAGCTTGATCTGCTGGCGCAGAAGTATTCCATAGAGCAGC

[0047] TGACCACTTACTGGCTGCAGCCAGGGGATGATTTTGAGGAGGCTATTAGGGTATATGCAAAGGTGGCACTTAGGCCAGATT

[0048] GCAAGTACAAGATCAGCAAACTTGTAAATATCAGGAATTGTTGCTACATTTCTGGGAACGGGGCCGAGGTGGAGATAGATA

[0049] CGGAGGATAGGGTGGCCTTTAGATGTAGCATGATAAATATGTGGCCGGGGGTGCTTGGCATGGACGGGGTGGTTATTATGA

[0050] ATGTAAGGTTTACTGGCCCCAATTTTAGCGGTACGGTTTTCCTGGCCAATACCAACCTTATCCTACACGGTGTAAGCTTCT

[0051] ATGGGTTTAACAATACCTGTGTGGAAGCCTGGACCGATGTAAGGGTTCGGGGCTGTGCCTTTTACTGCTGCTGGAAGGG...

Embodiment 2

[0131] The conditionally replicable oncolytic adenovirus HE1B55D-RGD.IL-24 / Trail vector in this example is as follows:

[0132] In Example 1, the first exogenous gene of Arresten inserted into an expression element expressing Arresten between 2245bp and 3327bp of the adenovirus genome was replaced with Trail. Other structures are the same as in Example 1, constituting a conditionally replicable oncolytic adenovirus HE1B55D-RGD.IL-24 / Trail vector.

[0133] Its construction method is the same as in Example 1.

Embodiment 3

[0135] The vector of conditionally replicable oncolytic adenovirus HE1B55D-RGD.IL-24 / Endostat in this example is as follows:

[0136] In Example 1, the first exogenous gene of Arresten inserted into an expression element expressing Arresten between 2245bp and 3327bp of the adenovirus genome was replaced with Endostatin. Other structures are the same as in Example 1, constituting a conditionally replicable oncolytic adenovirus HE1B55D-RGD.IL-24 / Endostat in vector.

[0137] Its construction method is the same as in Example 1.

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

No PUM Login to view more

Abstract

The invention relates to a conditionally replicating oncolytic adenoviral vector used for expressing two exogenous genes and modified by small peptide. Specifically, base 1083bp is deleted in the section of 2245bp-3327bp of human adenovirus type 5 genome, and an expression element expressing a first exogenous gene is inserted into the section of 2245bp-3327bp of human adenovirus type 5 genome. And at 32679bp of adenovirus type 5 genome, i.e. at the position of fibrin HI loop, a code containing a small peptide is inserted. A second exogenous gene of dual expression and an eGFP expression element are inserted into the section of 32787bp-32788bp of human adenovirus type 5 genome. The construction method of the vector includes the steps of: constructing a shuttle missed by pAd5E1B 55kd, constructing a shuttle of the first exogenous gene pHE1B55D-, constructing an adenoviral vector backbone of the first exogenous gene pHE1B55D- / SwaI, constructing a shuttle of the small peptide sequence pshuttle Ad5-E4-fiber-, constructing a shuttle expressing eGFP and the second exogenous gene, and preparing the conditionally replicating oncolytic adenoviral vector used for expressing two exogenous genes and modified by small peptide. The invention also provides the application of the adenoviral vector provided in the invention in preparing medicaments for treating tumours.

Description

technical field [0001] The invention relates to the field of tumor gene therapy, in particular to a conditional replicative oncolytic adenoviral vector for expression of two exogenous genes modified by small peptides and its construction method and application. Background technique [0002] Malignant tumors seriously threaten human health and are already a major cause of human death. Except for surgery, chemotherapy and radiotherapy, no effective treatment method has been found. It is extremely important to explore new treatment methods. Gene therapy is a new method emerging in recent years, and it has become one of the most promising programs in the treatment of malignant tumors. Gene therapy is divided into viral vectors and non-viral vectors, among which viral vectors are the most widely used, and the most eye-catching viral vector is conditionally replicating oncolytic adenoviral vector (CRAd). This type of vector can be selectively amplified in tumor tissue, and the am...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
Patent Type & Authority Patents(China)
IPC IPC(8): A61K48/00C12N15/861A61P35/00
Inventor 夏海滨刘世海
Owner SHAANXI NORMAL UNIV
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products